# This file contains a list of potential contaminants which are
# frequently found in high throughput sequencing reactions.  These
# are mostly sequences of adapters / primers used in the various
# sequencing chemistries.
# 
# Please DO NOT rely on these sequences to design your own oligos, some
# of them are truncated at ambiguous positions, and none of them are
# definitive sequences from the manufacturers so don't blame us if you
# try to use them and they don't work.
#
# You can add more sequences to the file by putting one line per entry
# and specifying a name[tab]sequence.  If the contaminant you add is 
# likely to be of use to others please consider sending it to the FastQ
# authors, either via a bug report at www.bioinformatics.bbsrc.ac.uk/bugzilla/
# or by directly emailing simon.andrews@bbsrc.ac.uk so other users of
# the program can benefit.
TestContaminant	ATGCATGCATGCATGCATGCATGC