Mercurial > repos > devteam > fastqc

comparison rgFastQC.xml @ 6:e8c90ad3cbf9 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fastqc commit df4c0b0c6372e2984966e220fa42ecd8a3d370e8
author devteam
date Mon, 31 Oct 2016 10:40:00 -0400
parents 93f27bdc08cd
children ec73b7c83b2c
comparison
equal deleted inserted replaced
5:93f27bdc08cd 6:e8c90ad3cbf9
1 <tool id="fastqc" name="FastQC" version="0.64"> 1 <tool id="fastqc" name="FastQC" version="0.66">
2 <description>Read Quality reports</description> 2 <description>Read Quality reports</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="0.11.4">FastQC</requirement> 4 <requirement type="package" version="0.11.5">fastqc</requirement>
5 </requirements> 5 </requirements>
6 <stdio> 6 <stdio>
7 <exit_code range="1:" /> 7 <exit_code range="1:" />
8 <exit_code range=":-1" /> 8 <exit_code range=":-1" />
9 <regex match="Error:" /> 9 <regex match="Error:" />
10 <regex match="Exception:" /> 10 <regex match="Exception:" />
11 </stdio> 11 </stdio>
12 <command interpreter="python"> 12 <command><![CDATA[
13 rgFastQC.py 13 python '$__tool_directory__'/rgFastQC.py
14 -i "$input_file" 14 -i "$input_file"
15 -d "$html_file.files_path" 15 -d "$html_file.files_path"
16 -o "$html_file" 16 -o "$html_file"
17 -t "$text_file" 17 -t "$text_file"
18 -f "$input_file.ext" 18 -f "$input_file.ext"
19 -j "$input_file.name" 19 -j "$input_file.name"
20 -e "\$FASTQC_JAR_PATH/fastqc"
21 #if $contaminants.dataset and str($contaminants) > '' 20 #if $contaminants.dataset and str($contaminants) > ''
22 -c "$contaminants" 21 -c "$contaminants"
23 #end if 22 #end if
24 #if $limits.dataset and str($limits) > '' 23 #if $limits.dataset and str($limits) > ''
25 -l "$limits" 24 -l "$limits"
26 #end if 25 #end if
27 </command> 26 ]]></command>
28 <inputs> 27 <inputs>
29 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> 28 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
30 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 29 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
31 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> 30 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
32 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" 31 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
33 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> 32 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
34 </inputs> 33 </inputs>
35 <outputs> 34 <outputs>
44 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> 43 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
45 </test> 44 </test>
46 <test> 45 <test>
47 <param name="input_file" value="1000gsample.fastq" /> 46 <param name="input_file" value="1000gsample.fastq" />
48 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" /> 47 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
49 <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/> 48 <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/>
50 <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/> 49 <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/>
51 </test> 50 </test>
52 </tests> 51 </tests>
53 <help> 52 <help>
54 53
55 .. class:: infomark 54 .. class:: infomark
56 55
57 **Purpose** 56 **Purpose**
58 57
59 FastQC aims to provide a simple way to do some quality control checks on raw 58 FastQC aims to provide a simple way to do some quality control checks on raw
60 sequence data coming from high throughput sequencing pipelines. 59 sequence data coming from high throughput sequencing pipelines.
61 It provides a modular set of analyses which you can use to give a quick 60 It provides a modular set of analyses which you can use to give a quick
62 impression of whether your data has any problems of 61 impression of whether your data has any problems of
63 which you should be aware before doing any further analysis. 62 which you should be aware before doing any further analysis.
64 63
65 The main functions of FastQC are: 64 The main functions of FastQC are:
66 65
67 - Import of data from BAM, SAM or FastQ files (any variant) 66 - Import of data from BAM, SAM or FastQ files (any variant)
90 89
91 .. class:: infomark 90 .. class:: infomark
92 91
93 **Inputs and outputs** 92 **Inputs and outputs**
94 93
95 FastQC_ is the best place to look for documentation - it's very good. 94 FastQC_ is the best place to look for documentation - it's very good.
96 A summary follows below for those in a tearing hurry. 95 A summary follows below for those in a tearing hurry.
97 96
98 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check. 97 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
99 It will also take an optional file containing a list of contaminants information, in the form of 98 It will also take an optional file containing a list of contaminants information, in the form of
100 a tab-delimited file with 2 columns, name and sequence. As another option the tool takes a custom 99 a tab-delimited file with 2 columns, name and sequence. As another option the tool takes a custom