Mercurial > repos > devteam > fastqc

comparison rgFastQC.xml @ 0:d5e4121e45ed draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Imported from capsule None
author devteam
date Thu, 23 Jan 2014 12:32:14 -0500
parents
children 67355741fbc3
comparison
equal deleted inserted replaced
-1:000000000000 0:d5e4121e45ed
1 <tool name="FastQC:Read QC" id="fastqc" version="0.52">
2 <description>reports using FastQC</description>
3 <command interpreter="python">
4 rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$JAVA_JAR_PATH/fastqc"
5 #if $contaminants.dataset and str($contaminants) > ''
6 -c "$contaminants"
7 #end if
8 </command>
9 <requirements>
10 <requirement type="package" version="0.10.1">FastQC</requirement>
11 </requirements>
12 <inputs>
13 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
14 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
15 help="Letters and numbers only please - other characters will be removed">
16 <sanitizer invalid_char="">
17 <valid initial="string.letters,string.digits"/>
18 </sanitizer>
19 </param>
20 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
21 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
22 </inputs>
23 <outputs>
24 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}.html" />
25 </outputs>
26 <tests>
27 <test>
28 <param name="input_file" value="1000gsample.fastq" />
29 <param name="out_prefix" value="fastqc_out" />
30 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
31 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
32 </test>
33 </tests>
34 <help>
35
36 .. class:: infomark
37
38 **Purpose**
39
40 FastQC aims to provide a simple way to do some quality control checks on raw
41 sequence data coming from high throughput sequencing pipelines.
42 It provides a modular set of analyses which you can use to give a quick
43 impression of whether your data has any problems of
44 which you should be aware before doing any further analysis.
45
46 The main functions of FastQC are:
47
48 - Import of data from BAM, SAM or FastQ files (any variant)
49 - Providing a quick overview to tell you in which areas there may be problems
50 - Summary graphs and tables to quickly assess your data
51 - Export of results to an HTML based permanent report
52 - Offline operation to allow automated generation of reports without running the interactive application
53
54
55 -----
56
57
58 .. class:: infomark
59
60 **FastQC**
61
62 This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_
63 Kindly acknowledge it as well as this tool if you use it.
64 FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
65
66 The contaminants file parameter was borrowed from the independently developed
67 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
68
69 -----
70
71 .. class:: infomark
72
73 **Inputs and outputs**
74
75 FastQC_ is the best place to look for documentation - it's very good.
76 A summary follows below for those in a tearing hurry.
77
78 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
79 It will also take an optional file containing a list of contaminants information, in the form of
80 a tab-delimited file with 2 columns, name and sequence.
81
82 The tool produces a single HTML output file that contains all of the results, including the following:
83
84 - Basic Statistics
85 - Per base sequence quality
86 - Per sequence quality scores
87 - Per base sequence content
88 - Per base GC content
89 - Per sequence GC content
90 - Per base N content
91 - Sequence Length Distribution
92 - Sequence Duplication Levels
93 - Overrepresented sequences
94 - Kmer Content
95
96 All except Basic Statistics and Overrepresented sequences are plots.
97 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
98 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
99
100 </help>
101 </tool>