Mercurial > repos > devteam > fastqc

comparison rgFastQC.xml @ 2:bf15645bae10 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded from GH
author devteam
date Wed, 12 Nov 2014 14:02:29 -0500
parents 67355741fbc3
children 36980a78cc83
comparison
equal deleted inserted replaced
1:67355741fbc3 2:bf15645bae10
1 <tool name="FastQC:Read QC" id="fastqc" version="0.62"> 1 <tool name="FastQC:Read QC" id="fastqc" version="0.62">
2 <description>reports using FastQC</description> 2 <description>reports using FastQC</description>
3 <command interpreter="python"> 3 <command interpreter="python">
4 rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -t "$text_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_JAR_PATH/fastqc" 4 rgFastQC.py
5 #if $contaminants.dataset and str($contaminants) > '' 5 -i "$input_file"
6 -c "$contaminants" 6 -d "$html_file.files_path"
7 #end if 7 -o "$html_file"
8 #if $limits.dataset and str($limits) > '' 8 -t "$text_file"
9 -l "$limits" 9 -n "$out_prefix"
10 #end if 10 -f "$input_file.ext"
11 -j "$input_file.name"
12 -e "\$FASTQC_JAR_PATH/fastqc"
13 #if $contaminants.dataset and str($contaminants) > ''
14 -c "$contaminants"
15 #end if
16 #if $limits.dataset and str($limits) > ''
17 -l "$limits"
18 #end if
11 </command> 19 </command>
12 <requirements> 20 <requirements>
13 <requirement type="package" version="0.11.2">FastQC</requirement> 21 <requirement type="package" version="0.11.2">FastQC</requirement>
14 </requirements> 22 </requirements>
15 <inputs> 23 <inputs>
21 </sanitizer> 29 </sanitizer>
22 </param> 30 </param>
23 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 31 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
24 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> 32 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
25 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" 33 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
26 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> 34 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
27 </inputs> 35 </inputs>
28 <outputs> 36 <outputs>
29 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}_Webpage.html" /> 37 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}_Webpage.html" />
30 <data format="txt" name="text_file" label="${out_prefix}_${input_file.name}_RawData.txt" /> 38 <data format="txt" name="text_file" label="${out_prefix}_${input_file.name}_RawData.txt" />
31 </outputs> 39 </outputs>
112 120
113 All except Basic Statistics and Overrepresented sequences are plots. 121 All except Basic Statistics and Overrepresented sequences are plots.
114 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ 122 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
115 .. _Picard-tools: http://picard.sourceforge.net/index.shtml 123 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
116 124
117 </help> 125 </help>
126 <citations>
127 <citation type="bibtex">
128 @ARTICLE{andrews_s,
129 author = {Andrews, S.},
130 keywords = {bioinformatics, ngs, qc},
131 priority = {2},
132 title = {{FastQC A Quality Control tool for High Throughput Sequence Data}},
133 url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/}
134 }
135 </citation>
136 </citations>
118 </tool> 137 </tool>