Mercurial > repos > devteam > fastqc

comparison rgFastQC.xml @ 13:7d8c56e1a3aa draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 35d722c0cafe2a2f2e4e2f73c265ae56ae237997
author iuc
date Fri, 24 Nov 2017 08:18:18 -0500
parents f5a25a56ab9d
children da652f6f84cc
comparison
equal deleted inserted replaced
12:919cf12bb71c 13:7d8c56e1a3aa
1 <tool id="fastqc" name="FastQC" version="0.69"> 1 <tool id="fastqc" name="FastQC" version="0.70">
2 <description>Read Quality reports</description> 2 <description>Read Quality reports</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="0.11.5">fastqc</requirement> 4 <requirement type="package" version="0.11.5">fastqc</requirement>
5 </requirements> 5 </requirements>
6 <command detect_errors="exit_code"><![CDATA[ 6 <command detect_errors="exit_code"><![CDATA[
7 #import re 7 #import re
8 #set input_name = re.sub('[^\w\-\s]', '_', str($input_file.element_identifier)) 8 #set input_name = re.sub('[^\w\-\s]', '_', str($input_file.element_identifier))
9 python '$__tool_directory__/rgFastQC.py' 9
10 -i '$input_file' 10 #if $input_file.ext.endswith('.gz'):
11 -d '$html_file.files_path' 11 #set input_file_sl = $input_name + '.gz'
12 -o '$html_file' 12 #elif $input_file.ext.endswith('.bz2'):
13 -t '$text_file' 13 #set input_file_sl = $input_name + '.bz2'
14 -f '$input_file.ext' 14 #else
15 -j '$input_name' 15 #set input_file_sl = $input_name
16 #end if
17
18 #if 'bam' in $input_file.ext:
19 #set format = 'bam'
20 #elif 'sam' in $input_file.ext:
21 #set format = 'sam'
22 #else
23 #set format = 'fastq'
24 #end if
25
26
27 ln -s '${input_file}' '${input_file_sl}' &&
28 mkdir -p '${html_file.files_path}' &&
29 fastqc
30 --outdir '${html_file.files_path}'
31
16 #if $contaminants.dataset and str($contaminants) > '' 32 #if $contaminants.dataset and str($contaminants) > ''
17 -c '$contaminants' 33 --contaminants '${contaminants}'
18 #end if 34 #end if
35
19 #if $limits.dataset and str($limits) > '' 36 #if $limits.dataset and str($limits) > ''
20 -l '$limits' 37 --limits '${limits}'
21 #end if 38 #end if
39
40 --quiet
41 --extract
42 -f '${format}'
43 '${input_file_sl}'
44
45 && cp '${html_file.files_path}'/*/fastqc_data.txt output.txt
46 && cp '${html_file.files_path}'/*\.html output.html
47
22 ]]></command> 48 ]]></command>
23 <inputs> 49 <inputs>
24 <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" 50 <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data"
25 label="Short read data from your current history" /> 51 label="Short read data from your current history" />
26 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 52 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
27 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" /> 53 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
28 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" 54 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
29 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> 55 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
30 </inputs> 56 </inputs>
31 <outputs> 57 <outputs>
32 <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" /> 58 <data format="html" name="html_file" from_work_dir="output.html" label="${tool.name} on ${on_string}: Webpage" />
33 <data format="txt" name="text_file" label="${tool.name} on ${on_string}: RawData" /> 59 <data format="txt" name="text_file" from_work_dir="output.txt" label="${tool.name} on ${on_string}: RawData" />
34 </outputs> 60 </outputs>
35 <tests> 61 <tests>
36 <test> 62 <test>
37 <param name="input_file" value="1000gsample.fastq" /> 63 <param name="input_file" value="1000gsample.fastq" />
38 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> 64 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
39 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> 65 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
40 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> 66 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="2"/>
41 </test> 67 </test>
42 <test> 68 <test>
43 <param name="input_file" value="1000gsample.fastq" /> 69 <param name="input_file" value="1000gsample.fastq" />
44 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" /> 70 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
45 <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/> 71 <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/>
46 <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/> 72 <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="2"/>
47 </test> 73 </test>
48 <test> 74 <test>
49 <param name="input_file" value="1000gsample.fastq.gz" ftype="fastq.gz" /> 75 <param name="input_file" value="1000gsample.fastq.gz" ftype="fastq.gz" />
50 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> 76 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
51 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> 77 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
52 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> 78 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="2"/>
53 </test> 79 </test>
54 <test> 80 <test>
55 <param name="input_file" value="1000gsample.fastq.bz2" ftype="fastq.bz2" /> 81 <param name="input_file" value="1000gsample.fastq.bz2" ftype="fastq.bz2" />
56 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> 82 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
57 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> 83 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
58 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> 84 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="2"/>
85 </test>
86 <test>
87 <param name="input_file" value="hisat_output_1.bam" ftype="bam" />
88 <output name="html_file" file="fastqc_report_hisat.html" ftype="html" lines_diff="100"/>
89 <output name="text_file" file="fastqc_data_hisat.txt" ftype="txt" lines_diff="2"/>
59 </test> 90 </test>
60 </tests> 91 </tests>
61 <help> 92 <help>
62 .. class:: infomark 93 .. class:: infomark
63 94