comparison rgFastQC.xml @ 1:67355741fbc3 draft

Uploaded from GH
author devteam
date Tue, 11 Nov 2014 12:18:17 -0500
parents d5e4121e45ed
children bf15645bae10
comparison
equal deleted inserted replaced
0:d5e4121e45ed 1:67355741fbc3
1 <tool name="FastQC:Read QC" id="fastqc" version="0.52"> 1 <tool name="FastQC:Read QC" id="fastqc" version="0.62">
2 <description>reports using FastQC</description> 2 <description>reports using FastQC</description>
3 <command interpreter="python"> 3 <command interpreter="python">
4 rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$JAVA_JAR_PATH/fastqc" 4 rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -t "$text_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_JAR_PATH/fastqc"
5 #if $contaminants.dataset and str($contaminants) > '' 5 #if $contaminants.dataset and str($contaminants) > ''
6 -c "$contaminants" 6 -c "$contaminants"
7 #end if 7 #end if
8 #if $limits.dataset and str($limits) > ''
9 -l "$limits"
10 #end if
8 </command> 11 </command>
9 <requirements> 12 <requirements>
10 <requirement type="package" version="0.10.1">FastQC</requirement> 13 <requirement type="package" version="0.11.2">FastQC</requirement>
11 </requirements> 14 </requirements>
12 <inputs> 15 <inputs>
13 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> 16 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
14 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" 17 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
15 help="Letters and numbers only please - other characters will be removed"> 18 help="Letters and numbers only please - other characters will be removed">
16 <sanitizer invalid_char=""> 19 <sanitizer invalid_char="">
17 <valid initial="string.letters,string.digits"/> 20 <valid initial="string.letters,string.digits"/>
18 </sanitizer> 21 </sanitizer>
19 </param> 22 </param>
20 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 23 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
21 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> 24 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
25 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
26 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
22 </inputs> 27 </inputs>
23 <outputs> 28 <outputs>
24 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}.html" /> 29 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}_Webpage.html" />
30 <data format="txt" name="text_file" label="${out_prefix}_${input_file.name}_RawData.txt" />
25 </outputs> 31 </outputs>
26 <tests> 32 <tests>
27 <test> 33 <test>
28 <param name="input_file" value="1000gsample.fastq" /> 34 <param name="input_file" value="1000gsample.fastq" />
29 <param name="out_prefix" value="fastqc_out" /> 35 <param name="out_prefix" value="fastqc_out" />
30 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> 36 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
31 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> 37 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
38 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
39 </test>
40 <test>
41 <param name="input_file" value="1000gsample.fastq" />
42 <param name="out_prefix" value="fastqc_out" />
43 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
44 <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
45 <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
32 </test> 46 </test>
33 </tests> 47 </tests>
34 <help> 48 <help>
35 49
36 .. class:: infomark 50 .. class:: infomark
63 Kindly acknowledge it as well as this tool if you use it. 77 Kindly acknowledge it as well as this tool if you use it.
64 FastQC incorporates the Picard-tools_ libraries for sam/bam processing. 78 FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
65 79
66 The contaminants file parameter was borrowed from the independently developed 80 The contaminants file parameter was borrowed from the independently developed
67 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. 81 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
82 Adaption to version 0.11.2 by T. McGowan.
68 83
69 ----- 84 -----
70 85
71 .. class:: infomark 86 .. class:: infomark
72 87
75 FastQC_ is the best place to look for documentation - it's very good. 90 FastQC_ is the best place to look for documentation - it's very good.
76 A summary follows below for those in a tearing hurry. 91 A summary follows below for those in a tearing hurry.
77 92
78 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check. 93 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
79 It will also take an optional file containing a list of contaminants information, in the form of 94 It will also take an optional file containing a list of contaminants information, in the form of
80 a tab-delimited file with 2 columns, name and sequence. 95 a tab-delimited file with 2 columns, name and sequence. As another option the tool takes a custom
96 limits.txt file that allows setting the warning thresholds for the different modules and also specifies
97 which modules to include in the output.
81 98
82 The tool produces a single HTML output file that contains all of the results, including the following: 99 The tool produces a basic text and a HTML output file that contain all of the results, including the following:
83 100
84 - Basic Statistics 101 - Basic Statistics
85 - Per base sequence quality 102 - Per base sequence quality
86 - Per sequence quality scores 103 - Per sequence quality scores
87 - Per base sequence content 104 - Per base sequence content