Mercurial > repos > devteam > fastqc
comparison rgFastQC.xml @ 3:36980a78cc83 draft
Uploaded
| author | devteam |
|---|---|
| date | Fri, 12 Dec 2014 10:55:06 -0500 |
| parents | bf15645bae10 |
| children | 93f27bdc08cd |
comparison
equal
deleted
inserted
replaced
| 2:bf15645bae10 | 3:36980a78cc83 |
|---|---|
| 1 <tool name="FastQC:Read QC" id="fastqc" version="0.62"> | 1 <tool id="fastqc" name="FastQC" version="0.63"> |
| 2 <description>reports using FastQC</description> | 2 <description>Read Quality reports</description> |
| 3 <command interpreter="python"> | 3 <requirements> |
| 4 rgFastQC.py | 4 <requirement type="package" version="0.11.2">FastQC</requirement> |
| 5 </requirements> | |
| 6 <stdio> | |
| 7 <exit_code range="1:" /> | |
| 8 <exit_code range=":-1" /> | |
| 9 <regex match="Error:" /> | |
| 10 <regex match="Exception:" /> | |
| 11 </stdio> | |
| 12 <command interpreter="python"> | |
| 13 rgFastQC.py | |
| 5 -i "$input_file" | 14 -i "$input_file" |
| 6 -d "$html_file.files_path" | 15 -d "$html_file.files_path" |
| 7 -o "$html_file" | 16 -o "$html_file" |
| 8 -t "$text_file" | 17 -t "$text_file" |
| 9 -n "$out_prefix" | |
| 10 -f "$input_file.ext" | 18 -f "$input_file.ext" |
| 11 -j "$input_file.name" | 19 -j "$input_file.name" |
| 12 -e "\$FASTQC_JAR_PATH/fastqc" | 20 -e "\$FASTQC_JAR_PATH/fastqc" |
| 13 #if $contaminants.dataset and str($contaminants) > '' | 21 #if $contaminants.dataset and str($contaminants) > '' |
| 14 -c "$contaminants" | 22 -c "$contaminants" |
| 15 #end if | 23 #end if |
| 16 #if $limits.dataset and str($limits) > '' | 24 #if $limits.dataset and str($limits) > '' |
| 17 -l "$limits" | 25 -l "$limits" |
| 18 #end if | 26 #end if |
| 19 </command> | 27 </command> |
| 20 <requirements> | 28 <inputs> |
| 21 <requirement type="package" version="0.11.2">FastQC</requirement> | 29 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> |
| 22 </requirements> | 30 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" |
| 23 <inputs> | 31 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> |
| 24 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> | 32 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" |
| 25 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" | 33 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> |
| 26 help="Letters and numbers only please - other characters will be removed"> | 34 </inputs> |
| 27 <sanitizer invalid_char=""> | 35 <outputs> |
| 28 <valid initial="string.letters,string.digits"/> | 36 <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" /> |
| 29 </sanitizer> | 37 <data format="txt" name="text_file" label="${tool.name} on ${on_string}: RawData" /> |
| 30 </param> | 38 </outputs> |
| 31 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" | 39 <tests> |
| 32 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> | 40 <test> |
| 33 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" | 41 <param name="input_file" value="1000gsample.fastq" /> |
| 34 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> | 42 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> |
| 35 </inputs> | 43 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> |
| 36 <outputs> | 44 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> |
| 37 <data format="html" name="html_file" label="${out_prefix}_${input_file.name}_Webpage.html" /> | 45 </test> |
| 38 <data format="txt" name="text_file" label="${out_prefix}_${input_file.name}_RawData.txt" /> | 46 <test> |
| 39 </outputs> | 47 <param name="input_file" value="1000gsample.fastq" /> |
| 40 <tests> | 48 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" /> |
| 41 <test> | 49 <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/> |
| 42 <param name="input_file" value="1000gsample.fastq" /> | 50 <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/> |
| 43 <param name="out_prefix" value="fastqc_out" /> | 51 </test> |
| 44 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> | 52 </tests> |
| 45 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> | 53 <help> |
| 46 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> | |
| 47 </test> | |
| 48 <test> | |
| 49 <param name="input_file" value="1000gsample.fastq" /> | |
| 50 <param name="out_prefix" value="fastqc_out" /> | |
| 51 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" /> | |
| 52 <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/> | |
| 53 <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/> | |
| 54 </test> | |
| 55 </tests> | |
| 56 <help> | |
| 57 | 54 |
| 58 .. class:: infomark | 55 .. class:: infomark |
| 59 | 56 |
| 60 **Purpose** | 57 **Purpose** |
| 61 | 58 |
