Mercurial > repos > devteam > fastqc

comparison rgFastQC.xml @ 10:1f6fd7a898bd draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 4b383d48868d7f3f6d35f242a0ee35953adcb037
author iuc
date Mon, 15 May 2017 08:34:27 -0400
parents 0a7c65540937
children f5a25a56ab9d
comparison
equal deleted inserted replaced
9:0a7c65540937 10:1f6fd7a898bd
23 #if $limits.dataset and str($limits) > '' 23 #if $limits.dataset and str($limits) > ''
24 -l '$limits' 24 -l '$limits'
25 #end if 25 #end if
26 ]]></command> 26 ]]></command>
27 <inputs> 27 <inputs>
28 <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> 28 <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data"
29 label="Short read data from your current history" />
29 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 30 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
30 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" /> 31 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
31 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" 32 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
32 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> 33 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
33 </inputs> 34 </inputs>
86 87
87 **FastQC** 88 **FastQC**
88 89
89 This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_ 90 This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_
90 Kindly acknowledge it as well as this tool if you use it. 91 Kindly acknowledge it as well as this tool if you use it.
91 FastQC incorporates the Picard-tools_ libraries for sam/bam processing. 92 FastQC incorporates the Picard-tools_ libraries for SAM/BAM processing.
92 93
93 The contaminants file parameter was borrowed from the independently developed 94 The contaminants file parameter was borrowed from the independently developed
94 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. 95 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
95 Adaption to version 0.11.2 by T. McGowan. 96 Adaption to version 0.11.2 by T. McGowan.
96 97
123 - Overrepresented sequences 124 - Overrepresented sequences
124 - Kmer Content 125 - Kmer Content
125 126
126 All except Basic Statistics and Overrepresented sequences are plots. 127 All except Basic Statistics and Overrepresented sequences are plots.
127 .. _FastQC: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ 128 .. _FastQC: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
128 .. _Picard-tools: http://picard.sourceforge.net/index.shtml 129 .. _Picard-tools: https://broadinstitute.github.io/picard/
129 </help> 130 </help>
130 <citations> 131 <citations>
131 <citation type="bibtex"> 132 <citation type="bibtex">
132 @unpublished{andrews_s, 133 @unpublished{andrews_s,
133 author = {Andrews, S.}, 134 author = {Andrews, S.},