Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_rna_original_sanger.fastqsanger @ 5:b77ecfa1664e draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/galaxy_sequence_utils/fastq_manipulation commit d4ced60a941c4c4a2fe95de9c09a10086810b387"
| author | iuc |
|---|---|
| date | Wed, 19 Feb 2020 16:55:55 +0000 |
| parents | de14b969d713 |
| children |
line wrap: on
line source
@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) ACGUACGUACGUACGUACGUACGUACGUACGUACGUACGUA + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) gUcauAGcgUcauAGcgUcauAGcgUcauAGcgUcauAGcg + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) ucagucagucagucagucagucagucagucagucagucagu + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI @FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) gaucrywsmkhbvdnGAUCRYWSMKHBVDN + DEFGHIDEFGHIDEFGHIDEFGHIDEFGHI
