bowtie2: bowtie2_wrapper.xml comparison

comparison bowtie2_wrapper.xml @ 11:fa69d5a7b8c8 draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd

author	devteam
date	Tue, 03 Jan 2017 10:50:44 -0500
parents	fed480fea9f0
children	ed052d843da7

comparison

equal deleted inserted replaced

-:fed480fea9f0
+:fa69d5a7b8c8
-<tool id="bowtie2" name="Bowtie2" version="2.2.6.1">
+<tool id="bowtie2" name="Bowtie2" version="2.2.8">
 <description>- map reads against reference genome</description>
 <macros>
 <import>read_group_macros.xml</import>
 </macros>
+<requirements>
+<requirement type="package" version="2.2.8">bowtie2</requirement>
+<requirement type="package" version="1.3.1">samtools</requirement>
+</requirements>
 <version_command>bowtie2 --version</version_command>
-<requirements>
+<command detect_errors="exit_code"><![CDATA[
-<requirement type="package" version="2.2.6">bowtie2</requirement>
-<requirement type="package" version="1.2">samtools</requirement>
-</requirements>
-<command>
 ## prepare bowtie2 index
 #set index_path = ''
 #if str($reference_genome.source) == "history":
-bowtie2-build "$reference_genome.own_file" genome &amp;&amp;
+bowtie2-build --threads \${GALAXY_SLOTS:-4} '$reference_genome.own_file' genome &&
-ln -s "$reference_genome.own_file" genome.fa &amp;&amp;
+ln -s -f '$reference_genome.own_file' genome.fa &&
 #set index_path = 'genome'
 #else:
-#set index_path = $reference_genome.index.fields.path
+#set index_path = '$reference_genome.index.fields.path'
 #end if
 ## execute bowtie2
 bowtie2
 ## number of threads
 -p \${GALAXY_SLOTS:-4}
 ## index file path
--x $index_path
+-x '$index_path'
 ## Fastq inputs
 #if str( $library.type ) == "single":
--U "${library.input_1}"
+-U '${library.input_1}'
 #if str( $library.unaligned_file ) == "true":
---un $output_unaligned_reads_l
+--un '$output_unaligned_reads_l'
+#end if
+#if str( $library.aligned_file ) == "true":
+--al '$output_aligned_reads_l'
 #end if
 #elif str( $library.type ) == "paired":
--1 "${library.input_1}"
+-1 '${library.input_1}'
--2 "${library.input_2}"
+-2 '${library.input_2}'
 #if str( $library.paired_options.paired_options_selector ) == "yes":
 -I "${library.paired_options.I}"
 -X "${library.paired_options.X}"
 ${library.paired_options.fr_rf_ff}
 ${library.paired_options.no_mixed}
 ${library.paired_options.no_contain}
 ${library.paired_options.no_overlap}
 #end if
 #if str( $library.unaligned_file ) == "true":
 --un-conc $output_unaligned_reads_l
+#end if
+#if str( $library.aligned_file ) == "true":
+--al-conc $output_aligned_reads_l
 #end if
 #else
 ## prepare collection
 -1 $library.input_1.forward
 -2 $library.input_1.reverse
 ${library.paired_options.dovetail}
 ${library.paired_options.no_contain}
 ${library.paired_options.no_overlap}
 #end if
 #if str( $library.unaligned_file ) == "true":
---un-conc $output_unaligned_reads_l
+--un-conc '$output_unaligned_reads_l'
 #end if
 #end if
 ## Read group information.
 @define_read_group_helpers@
 ${analysis_type.cline}
 #end if
 ## mapping stats (i.e. stderr from bowtie2)
 #if $save_mapping_stats
-	  2&gt; "$mapping_stats"
+2> '$mapping_stats'
 #end if
 ## output file
 #if ( str( $analysis_type.analysis_type_selector ) != "full" or str( $analysis_type.sam_opt ) != "true" ):
-| samtools view -Su - | samtools sort -o - - &gt; $output
+| samtools sort -O bam -o '$output'
 #else
-&gt; $output_sam
+> '$output_sam'
 #end if
 ## rename unaligned sequence files
 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r:
 #from os.path import splitext
 #set _unaligned_root, _unaligned_ext = splitext( str( $output_unaligned_reads_l ) )
-&amp;&amp; mv "${ _unaligned_root }.1${_unaligned_ext}" "${ output_unaligned_reads_l }"
+&& mv "${ _unaligned_root }.1${_unaligned_ext}" '$output_unaligned_reads_l'
-&amp;&amp; mv "${ _unaligned_root }.2${_unaligned_ext}" "${ output_unaligned_reads_r }"
+&& mv "${ _unaligned_root }.2${_unaligned_ext}" '$output_unaligned_reads_r'
 #end if
+#if $library.type == "paired" and $output_aligned_reads_l and $output_aligned_reads_r:
-</command>
+#from os.path import splitext
-<!-- basic error handling -->
+#set _aligned_root, _aligned_ext = splitext( str( $output_aligned_reads_l ) )
-<stdio>
+&& mv "${ _aligned_root }.1${_aligned_ext}" '$output_aligned_reads_l'
-<exit_code range="1:" level="fatal" description="Tool exception" />
+&& mv "${ _aligned_root }.2${_aligned_ext}" '$output_aligned_reads_r'
-</stdio>
+#end if
+]]></command>
 <inputs>
 <!-- single/paired -->
 <conditional name="library">
 <param name="type" type="select" label="Is this single or paired library">
 <option value="single">Single-end</option>
 </param>
 <when value="single">
 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Must be of datatype &quot;fastqsanger&quot;" />
 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
+<param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
 </when>
 <when value="paired">
 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file #1" help="Must be of datatype &quot;fastqsanger&quot;" />
 <param name="input_2" format="fastqsanger" type="data" label="FASTQ file #2" help="Must be of datatype &quot;fastqsanger&quot;" />
 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
+<param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
 <conditional name="paired_options">
 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See &quot;Alignment Options&quot; section of Help below for information">
 <option value="no" selected="True">No</option>
 <option value="yes">Yes</option>
 </param>
 </conditional>
 </when>
 <when value="paired_collection">
 <param name="input_1" format="fastqsanger" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype &quot;fastqsanger&quot;" />
 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
+<param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
 <conditional name="paired_options">
 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See &quot;Alignment Options&quot; section of Help below for information">
 <option value="no" selected="True">No</option>
 <option value="yes">Yes</option>
 </param>
 <!-- do nothing -->
 </when>
 </conditional>
 </when>
 </conditional>
 <!-- reference genome -->
 <conditional name="reference_genome">
 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below">
 <option value="indexed">Use a built-in genome index</option>
 <option value="history">Use a genome from the history and build index</option>
 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
 </options>
 </param>
 </when>
 <when value="history">
-<param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select reference genome" />
+<param name="own_file" type="data" format="fasta" label="Select reference genome" />
 </when>
 </conditional>
 <!-- read group settings -->
 <expand macro="read_group_conditional" />
 <conditional name="analysis_type">
 <param name="analysis_type_selector" type="select" label="Select analysis mode">
 <option value="simple">1: Default setting only</option>
 <param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/>
 <param name="i" type="text" value="S,1,1.15" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/>
 <param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/>
 <param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/>
 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/>
-<param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
+<param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
-<param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
+<param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
-<param name="norc" type="boolean" truevalue="--norc" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
+<param name="norc" type="boolean" truevalue="--norc" falsevalue="" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
-<param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the multiseed heuristic.  Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments.  However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`.  For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported.  This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
+<param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the multiseed heuristic.  Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments.  However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`.  For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported.  This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
 <conditional name="align_mode">
 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end">
 <option value="end-to-end" selected="True">End to End (--end-to-end)</option>
 <option value="local">Local (--local)</option>
 </param>
 </when>
 <when value="no">
 <!-- do nothing -->
 </when>
 </conditional>
 <conditional name="sam_options">
 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See &quot;Output Options&quot; section of Help below for information">
 <option value="yes">Yes</option>
 <option value="no" selected="true">No</option>
 </param>
 </conditional>
 <param name="save_mapping_stats" type="boolean" checked="False" label="Save the bowtie2 mapping statistics to the history" />
 </inputs>
 <!-- define outputs -->
 <outputs>
 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" >
 <filter>library['unaligned_file'] is True</filter>
 <actions>
 <conditional name="library.type">
 <when value="single">
 </action>
 </when>
 <when value="paired_collection">
 <action type="format">
 <option type="from_param" name="library.input_1" param_attribute="forward.ext" />
+</action>
+</when>
+</conditional>
+</actions>
+</data>
+<data format="fastqsanger" name="output_aligned_reads_l" label="${tool.name} on ${on_string}: aligned reads (L)" >
+<filter>library['aligned_file'] is True</filter>
+<actions>
+<conditional name="library.type">
+<when value="single">
+<action type="format">
+<option type="from_param" name="library.input_1" param_attribute="ext" />
+</action>
+</when>
+<when value="paired">
+<action type="format">
+<option type="from_param" name="library.input_1" param_attribute="ext" />
+</action>
+</when>
+<when value="paired_collection">
+<action type="format">
+<option type="from_param" name="library.input_1" param_attribute="forward.ext" />
+</action>
+</when>
+</conditional>
+</actions>
+</data>
+<data format="fastqsanger" name="output_aligned_reads_r" label="${tool.name} on ${on_string}: aligned reads (R)">
+<filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['aligned_file'] is True</filter>
+<actions>
+<conditional name="library.type">
+<when value="paired">
+<action type="format">
+<option type="from_param" name="library.input_2" param_attribute="ext" />
+</action>
+</when>
+<when value="paired_collection">
+<action type="format">
+<option type="from_param" name="library.input_1" param_attribute="reverse.ext" />
 </action>
 </when>
 </conditional>
 </actions>
 </data>
 </action>
 </when>
 </conditional>
 </actions>
 </data>
 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)">
 <filter>analysis_type['analysis_type_selector'] == "simple" or analysis_type['sam_opt'] is False</filter>
 <actions>
 <conditional name="reference_genome.source">
 <when value="indexed">
 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/>
 </test>
 </tests>
-<help>
+<help><![CDATA[
 **Bowtie2 Overview**
 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site.
 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead.
 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/
 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
 **Selecting reference genomes for Bowtie2**
 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using **Will you select a reference genome from your history or use a built-in index?** flag. This flag has two options:
 1. **Use a built-in genome index** - when selected (this is default), Galaxy provides the user with **Select reference genome index** dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against.
 2. **Use a genome from the history and build index** - when selected, Galaxy provides the user with **Select reference genome sequence** dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2.
 If your genome of interest is not listed here you have two choices:
 1. Contact galaxy team using **Help->Support** link at the top of the interface and let us know that an index needs to be added
 2. Upload your genome of interest as a FASTA file to Galaxy history and selected **Use a genome from the history and build index** option.
 ------
 **Input options**::
--s/--skip &lt;int&gt;
+-s/--skip <int>
-Skip (i.e. do not align) the first `&lt;int&gt;` reads or pairs in the input.
+Skip (i.e. do not align) the first `<int>` reads or pairs in the input.
--u/--qupto &lt;int&gt;
+-u/--qupto <int>
-Align the first `&lt;int&gt;` reads or read pairs from the input (after the
+Align the first `<int>` reads or read pairs from the input (after the
 `-s`/`--skip` reads or pairs have been skipped), then stop.  Default: no limit.
--5/--trim5 &lt;int&gt;
+-5/--trim5 <int>
-Trim `&lt;int&gt;` bases from 5' (left) end of each read before alignment (default: 0).
+Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0).
--3/--trim3 &lt;int&gt;
+-3/--trim3 <int>
-Trim `&lt;int&gt;` bases from 3' (right) end of each read before alignment (default: 0).
+Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0).
 --phred33
 Input qualities are ASCII chars equal to the Phred quality plus 33.  This is
 also called the "Phred+33" encoding, which is used by the very latest Illumina
 pipelines.
 --int-quals
 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
 Integers are treated as being on the Phred quality scale unless
 `--solexa-quals` is also specified. Default: off.
 ------
 **Presets in `--end-to-end` mode**::
 --very-fast
 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50`
 --fast
 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50`
 --sensitive
 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode)
 --very-sensitive
 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
 --sensitive-local
 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode)
 --very-sensitive-local
 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
 ------
 **Alignment options**::
--N &lt;int&gt;
+-N <int>
 Sets the number of mismatches to allowed in a seed alignment during multiseed
 alignment.  Can be set to 0 or 1. Setting this higher makes alignment slower
 (often much slower) but increases sensitivity.  Default: 0.
--L &lt;int&gt;
+-L <int>
 Sets the length of the seed substrings to align during multiseed alignment.
 Smaller values make alignment slower but more sensitive. Default: the
 `--sensitive` preset is used by default, which sets `-L` to 22 in
 `--end-to-end` mode and to 20 in `--local` mode.
--i &lt;func&gt;
+-i <func>
 Sets a function governing the interval between seed substrings to use during
 multiseed alignment.  For instance, if the read has 30 characers, and seed
 length is 10, and the seed interval is 6, the seeds extracted will be:
 Read:      TAGCTACGCTCTACGCTATCATGCATAAAC
 If the function returns a result less than
 1, it is rounded up to 1. Default: the `--sensitive` preset is used by
 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75`
 in `--local` mode.
---n-ceil &lt;func&gt;
+--n-ceil <func>
 Sets a function governing the maximum number of ambiguous characters (usually
 `N`s and/or `.`s) allowed in a read as a function of read length.  For instance,
 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
 where x is the read length.  Reads exceeding this ceiling are filtered out.
 Default: `L,0,0.15`.
---dpad &lt;int&gt;
+--dpad <int>
-"Pads" dynamic programming problems by `&lt;int&gt;` columns on either side to allow
+"Pads" dynamic programming problems by `<int>` columns on either side to allow
 gaps.  Default: 15.
---gbar &lt;int&gt;
+--gbar <int>
-Disallow gaps within `&lt;int&gt;` positions of the beginning or end of the read.
+Disallow gaps within `<int>` positions of the beginning or end of the read.
 Default: 4.
 --ignore-quals
 When calculating a mismatch penalty, always consider the quality value at the
 mismatched position to be the highest possible, regardless of the actual value.
 I.e. input is treated as though all quality values are high.  This is also the
 default behavior when the input doesn't specify quality values (e.g. in `-f`,
 `-r`, or `-c` modes).
 --nofw/--norc
 the forward (Watson) reference strand.  If `--norc` is specified, `bowtie2` will
 not attempt to align unpaired reads against the reverse-complement (Crick)
 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those
 paired-end configurations corresponding to fragments from the reverse-complement
 (Crick) strand.  Default: both strands enabled.
 --no-1mm-upfront
 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch
 end-to-end alignment for the read *before* trying the multiseed heuristic.  Such
 alignments can be found very quickly, and many short read alignments have exact or
 `--ma` is used in this mode, and the best possible alignment score is equal to
 the match bonus (`--ma`) times the length of the read.  Specifying `--local`
 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying
 the local version of the preset (`--very-fast-local`).  This is mutually
 exclusive with `--end-to-end`.  `--end-to-end` is the default mode.
 -----
 **Scoring options**::
---ma &lt;int&gt;
+--ma <int>
-Sets the match bonus.  In `--local` mode `&lt;int&gt;` is added to the alignment
+Sets the match bonus.  In `--local` mode `<int>` is added to the alignment
 score for each position where a read character aligns to a reference character
 and the characters match.  Not used in `--end-to-end` mode.  Default: 2.
 --mp MX,MN
 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers.  A
 aligns to a reference character, the characters do not match, and neither is an
 `N`.  If `--ignore-quals` is specified, the number subtracted quals `MX`.
 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
 where Q is the Phred quality value.  Default: `MX` = 6, `MN` = 2.
---np &lt;int&gt;
+--np <int>
 Sets penalty for positions where the read, reference, or both, contain an
 ambiguous character such as `N`.  Default: 1.
---rdg &lt;int1&gt;,&lt;int2&gt;
+--rdg <int1>,<int2>
-Sets the read gap open (`&lt;int1&gt;`) and extend (`&lt;int2&gt;`) penalties.  A read gap of
+Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties.  A read gap of
-length N gets a penalty of `&lt;int1&gt;` + N * `&lt;int2&gt;`.  Default: 5, 3.
+length N gets a penalty of `<int1>` + N * `<int2>`.  Default: 5, 3.
---rfg &lt;int1&gt;,&lt;int2&gt;
+--rfg <int1>,<int2>
-Sets the reference gap open (`&lt;int1&gt;`) and extend (`&lt;int2&gt;`) penalties.  A
+Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties.  A
-reference gap of length N gets a penalty of `&lt;int1&gt;` + N * `&lt;int2&gt;`.  Default:
+reference gap of length N gets a penalty of `<int1>` + N * `<int2>`.  Default:
 5, 3.
---score-min &lt;func&gt;
+--score-min <func>
 Sets a function governing the minimum alignment score needed for an alignment to
 be considered "valid" (i.e. good enough to report).  This is a function of read
 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
 to `f(x) = 0 + -0.6 * x`, where `x` is the read length.  The default in `--end-to-end` mode is `L,-0.6,-0.6` and
 the default in `--local` mode is `G,20,8`.
 -----
 **Reporting options**::
--k &lt;int&gt;
+-k <int>
 By default, `bowtie2` searches for distinct, valid alignments for each read.
 When it finds a valid alignment, it continues looking for alignments that are
 nearly as good or better.  The best alignment found is reported (randomly
 selected from among best if tied).  Information about the best alignments is
 used to estimate mapping quality and to set SAM optional fields, such as
 `AS:i` and `XS:i`.
 When `-k` is specified, however, `bowtie2` behaves differently.  Instead, it
-searches for at most `&lt;int&gt;` distinct, valid alignments for each read.  The
+searches for at most `<int>` distinct, valid alignments for each read.  The
 search terminates when it can't find more distinct valid alignments, or when it
-finds `&lt;int&gt;`, whichever happens first.  All alignments found are reported in
+finds `<int>`, whichever happens first.  All alignments found are reported in
 descending order by alignment score. The alignment score for a paired-end
 alignment equals the sum of the alignment scores of the individual mates. Each
 reported read or pair alignment beyond the first has the SAM 'secondary' bit
 (which equals 256) set in its FLAGS field.  For reads that have more than
-`&lt;int&gt;` distinct, valid alignments, `bowtie2` does not guarantee that the
+`<int>` distinct, valid alignments, `bowtie2` does not guarantee that the
-`&lt;int&gt;` alignments reported are the best possible in terms of alignment score.
+`<int>` alignments reported are the best possible in terms of alignment score.
 `-k` is mutually exclusive with `-a`.
 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when
 aligning reads to long, repetitive genomes large `-k` can be very, very slow.
 Like `-k` but with no upper limit on number of alignments to search for.  `-a`
 is mutually exclusive with `-k`.
 Note: Bowtie 2 is not designed with `-a` mode in mind, and when
 aligning reads to long, repetitive genomes this mode can be very, very slow.
 -----
 **Effort options**::
--D &lt;int&gt;
+-D <int>
-Up to `&lt;int&gt;` consecutive seed extension attempts can "fail" before Bowtie 2
+Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2
 moves on, using the alignments found so far.  A seed extension "fails" if it
 does not yield a new best or a new second-best alignment.  This limit is
 automatically adjusted up when -k or -a are specified.  Default: 15.
--R &lt;int&gt;
+-R <int>
-`&lt;int&gt;` is the maximum number of times Bowtie 2 will "re-seed" reads with
+`<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with
 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads
 (same length, same number of mismatches allowed) at different offsets and
 searches for more alignments.  A read is considered to have repetitive seeds if
 the total number of seed hits divided by the number of seeds that aligned at
 least once is greater than 300.  Default: 2.
 -----
 **Paired-end options**::
--I/--minins &lt;int&gt;
+-I/--minins <int>
 The minimum fragment length for valid paired-end alignments.  E.g. if `-I 60` is
 specified and a paired-end alignment consists of two 20-bp alignments in the
 appropriate orientation with a 20-bp gap between them, that alignment is
 considered valid (as long as `-X` is also satisfied).  A 19-bp gap would not
 be valid in that case.  If trimming options `-3` or `-5` are also used, the
 run.  This is because larger differences bewteen `-I` and `-X` require that
 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
 efficient.
 Default: 0 (essentially imposing no minimum)
--X/--maxins &lt;int&gt;
+-X/--maxins <int>
 The maximum fragment length for valid paired-end alignments.  E.g. if `-X 100`
 is specified and a paired-end alignment consists of two 20-bp alignments in the
 proper orientation with a 60-bp gap between them, that alignment is considered
 valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in
 that case.  If trimming options `-3` or `-5` are also used, the `-X`
 Default: a mate can contain the other in a concordant alignment.
 --no-overlap
 If one mate alignment overlaps the other at all, consider that to be
 non-concordant.  Default: mates can overlap in a concordant alignment.
 ------
 **SAM options**::
---rg-id &lt;text&gt;
+--rg-id <text>
-Set the read group ID to `&lt;text&gt;`.  This causes the SAM `@RG` header line to be
+Set the read group ID to `<text>`.  This causes the SAM `@RG` header line to be
-printed, with `&lt;text&gt;` as the value associated with the `ID:` tag.  It also
+printed, with `<text>` as the value associated with the `ID:` tag.  It also
 causes the `RG:Z:` extra field to be attached to each SAM output record, with
-value set to `&lt;text&gt;`.
+value set to `<text>`.
---rg &lt;text&gt;
+--rg <text>
-Add `&lt;text&gt;` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
+Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
 `@RG` header line.  Note: in order for the `@RG` line to appear, `--rg-id`
 must also be specified.  This is because the `ID` tag is required by the SAM
 Specification.  Specify `--rg` multiple times to set multiple fields.  See the
 SAM Specification for details about what fields are legal.
 --omit-sec-seq
 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`
 and `QUAL` strings.  Specifying this option causes Bowtie 2 to print an asterix
 in those fields instead.
 -----
 **Other options**::
 --reorder
 than 1.  Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie
 2 to run somewhat slower and use somewhat more memory then if `--reorder` were
 not specified.  Has no effect if `-p` is set to 1, since output order will
 naturally correspond to input order in that case.
---seed &lt;int&gt;
+--seed <int>
-Use `&lt;int&gt;` as the seed for pseudo-random number generator.  Default: 0.
+Use `<int>` as the seed for pseudo-random number generator.  Default: 0.
 --non-deterministic
 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read.  It
 seeds the generator with a number derived from (a) the read name, (b) the
 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed`
 current time.  This means that Bowtie 2 will not necessarily report the same
 alignment for two identical reads.  This is counter-intuitive for some users,
 but might be more appropriate in situations where the input consists of many
 identical reads.
-</help>
+]]></help>
 <citations>
 <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
 <citation type="doi">10.1038/nmeth.1923</citation>
 </citations>
 </tool>

Mercurial > repos > devteam > bowtie2

comparison bowtie2_wrapper.xml @ 11:fa69d5a7b8c8 draft