Mercurial > repos > devteam > bowtie2

comparison bowtie2_wrapper.xml @ 15:7e0b333f39e1 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bowtie2 commit cf554b9b69c32acb484c34fdc60384fa49c7c482
author iuc
date Thu, 01 Jun 2017 06:46:49 -0400
parents 85f0e9edb32d
children def46fdb3909
comparison
equal deleted inserted replaced
14:85f0e9edb32d 15:7e0b333f39e1
1 <tool id="bowtie2" name="Bowtie2" version="2.3.0.1" profile="17.01"> 1 <tool id="bowtie2" name="Bowtie2" version="2.3.2.1" profile="17.01">
2 <description>- map reads against reference genome</description> 2 <description>- map reads against reference genome</description>
3 <macros> 3 <macros>
4 <import>read_group_macros.xml</import> 4 <import>bowtie2_macros.xml</import>
5 </macros> 5 </macros>
6 <requirements> 6 <requirements>
7 <requirement type="package" version="2.3.0">bowtie2</requirement> 7 <requirement type="package" version="2.3.2">bowtie2</requirement>
8 <requirement type="package" version="1.3.1">samtools</requirement> 8 <requirement type="package" version="1.3.1">samtools</requirement>
9 </requirements> 9 </requirements>
10 <version_command>bowtie2 --version</version_command> 10 <version_command>bowtie2 --version</version_command>
11 <command detect_errors="exit_code"><![CDATA[ 11 <command detect_errors="exit_code"><![CDATA[
12 ## prepare bowtie2 index 12 ## prepare bowtie2 index
64 #set compressed = "BZ2" 64 #set compressed = "BZ2"
65 #else: 65 #else:
66 #set read2 = "input_r.fastq" 66 #set read2 = "input_r.fastq"
67 #end if 67 #end if
68 ln -s '${library.input_1.reverse}' ${read2} && 68 ln -s '${library.input_1.reverse}' ${read2} &&
69
70 #else if str($library.type) == 'paired_interleaved':
71 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
72 #set read1 = "input_il.fastq.gz"
73 #set compressed = "GZ"
74 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
75 #set read1 = "input_il.fastq.bz2"
76 #set compressed = "BZ2"
77 #else:
78 #set read1 = "input_il.fastq"
79 #end if
80 ln -s '${library.input_1}' ${read1} &&
69 #else: 81 #else:
70 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"): 82 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
71 #set read1 = "input_f.fastq.gz" 83 #set read1 = "input_f.fastq.gz"
72 #set compressed = "GZ" 84 #set compressed = "GZ"
73 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"): 85 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
90 -x '$index_path' 102 -x '$index_path'
91 103
92 ## Fastq inputs 104 ## Fastq inputs
93 #if str( $library.type ) == "single": 105 #if str( $library.type ) == "single":
94 -U '${read1}' 106 -U '${read1}'
107 #if str( $library.unaligned_file ) == "true":
108 #if $compressed == "GZ":
109 --un-gz '${output_unaligned_reads_l}'
110 #else if $compressed == "BZ2":
111 --un-bz2 '${output_unaligned_reads_l}'
112 #else:
113 --un '${output_unaligned_reads_l}'
114 #end if
115 #end if
116 #if str( $library.aligned_file ) == "true":
117 #if $compressed == "GZ":
118 --al-gz '${output_aligned_reads_l}'
119 #else if $compressed == "BZ2":
120 --al-bz2 '${output_aligned_reads_l}'
121 #else:
122 --al '${output_aligned_reads_l}'
123 #end if
124 #end if
125
126 #elif str( $library.type ) == "paired_interleaved":
127 --interleaved '${read1}'
95 #if str( $library.unaligned_file ) == "true": 128 #if str( $library.unaligned_file ) == "true":
96 #if $compressed == "GZ": 129 #if $compressed == "GZ":
97 --un-gz '${output_unaligned_reads_l}' 130 --un-gz '${output_unaligned_reads_l}'
98 #else if $compressed == "BZ2": 131 #else if $compressed == "BZ2":
99 --un-bz2 '${output_unaligned_reads_l}' 132 --un-bz2 '${output_unaligned_reads_l}'
271 <conditional name="library"> 304 <conditional name="library">
272 <param name="type" type="select" label="Is this single or paired library"> 305 <param name="type" type="select" label="Is this single or paired library">
273 <option value="single">Single-end</option> 306 <option value="single">Single-end</option>
274 <option value="paired">Paired-end</option> 307 <option value="paired">Paired-end</option>
275 <option value="paired_collection">Paired-end Dataset Collection</option> 308 <option value="paired_collection">Paired-end Dataset Collection</option>
309 <option value="paired_interleaved">Paired-end data from single interleaved dataset</option>
276 </param> 310 </param>
277 311
278 <when value="single"> 312 <when value="single">
279 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file" help="Must be of datatype &quot;fastqsanger&quot;" /> 313 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file" help="Must be of datatype &quot;fastqsanger&quot;" />
280 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" /> 314
281 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" /> 315 <expand macro="align_unalign" />
316
282 </when> 317 </when>
283 <when value="paired"> 318 <when value="paired">
284 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #1" help="Must be of datatype &quot;fastqsanger&quot;" /> 319 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #1" help="Must be of datatype &quot;fastqsanger&quot;" />
285 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #2" help="Must be of datatype &quot;fastqsanger&quot;" /> 320 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #2" help="Must be of datatype &quot;fastqsanger&quot;" />
286 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" /> 321
287 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" /> 322 <expand macro="align_unalign" />
288 <conditional name="paired_options"> 323 <expand macro="paired_end_options" />
289 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See &quot;Alignment Options&quot; section of Help below for information"> 324
290 <option value="no" selected="True">No</option>
291 <option value="yes">Yes</option>
292 </param>
293 <when value="yes">
294 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
295 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
296 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
297 <option value="--fr" selected="True">--fr</option>
298 <option value="--rf">--rf</option>
299 <option value="--ff">--ff</option>
300 </param>
301 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
302 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
303 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
304 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
305 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
306 </when>
307 <when value="no">
308 <!-- do nothing -->
309 </when>
310 </conditional>
311 </when> 325 </when>
312 <when value="paired_collection"> 326 <when value="paired_collection">
313 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype &quot;fastqsanger&quot;" /> 327 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype &quot;fastqsanger&quot;" />
314 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" /> 328
315 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" /> 329 <expand macro="align_unalign" />
316 <conditional name="paired_options"> 330 <expand macro="paired_end_options" />
317 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See &quot;Alignment Options&quot; section of Help below for information"> 331
318 <option value="no" selected="True">No</option> 332 </when>
319 <option value="yes">Yes</option> 333 <when value="paired_interleaved">
320 </param> 334 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="Interleaved FASTQ file" help="Must be of datatype &quot;fastqsanger&quot;. --interleaved"/>
321 <when value="yes"> 335
322 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/> 336 <expand macro="align_unalign" />
323 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/> 337 <expand macro="paired_end_options" />
324 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)"> 338
325 <option value="--fr" selected="True">--fr</option>
326 <option value="--rf">--rf</option>
327 <option value="--ff">--ff</option>
328 </param>
329 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
330 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
331 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
332 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
333 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
334 </when>
335 <when value="no">
336 <!-- do nothing -->
337 </when>
338 </conditional>
339 </when> 339 </when>
340 </conditional> 340 </conditional>
341 341
342 <!-- reference genome --> 342 <!-- reference genome -->
343 <conditional name="reference_genome"> 343 <conditional name="reference_genome">
646 646
647 <tests> 647 <tests>
648 <test> 648 <test>
649 <!-- basic test on single paired default run --> 649 <!-- basic test on single paired default run -->
650 <param name="type" value="paired"/> 650 <param name="type" value="paired"/>
651 <param name="selection" value="no"/>
652 <param name="paired_options_selector" value="no"/> 651 <param name="paired_options_selector" value="no"/>
653 <param name="unaligned_file" value="false"/> 652 <param name="unaligned_file" value="false"/>
654 <param name="analysis_type_selector" value="simple"/> 653 <param name="analysis_type_selector" value="simple"/>
655 <param name="source" value="history" /> 654 <param name="source" value="history" />
656 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/> 655 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
659 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> 658 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
660 </test> 659 </test>
661 <test> 660 <test>
662 <!-- basic test on single paired default run --> 661 <!-- basic test on single paired default run -->
663 <param name="type" value="paired"/> 662 <param name="type" value="paired"/>
664 <param name="selection" value="no"/>
665 <param name="paired_options_selector" value="no"/> 663 <param name="paired_options_selector" value="no"/>
666 <param name="unaligned_file" value="false"/> 664 <param name="unaligned_file" value="false"/>
667 <param name="analysis_type_selector" value="simple"/> 665 <param name="analysis_type_selector" value="simple"/>
668 <param name="rg_selector" value="set"/> 666 <param name="rg_selector" value="set"/>
669 <param name="ID" value="rg1"/> 667 <param name="ID" value="rg1"/>
675 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/> 673 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/>
676 </test> 674 </test>
677 <test> 675 <test>
678 <!-- basic test on single paired default run with stats--> 676 <!-- basic test on single paired default run with stats-->
679 <param name="type" value="paired"/> 677 <param name="type" value="paired"/>
680 <param name="selection" value="no"/>
681 <param name="paired_options_selector" value="no"/> 678 <param name="paired_options_selector" value="no"/>
682 <param name="unaligned_file" value="false"/> 679 <param name="unaligned_file" value="false"/>
683 <param name="analysis_type_selector" value="simple"/> 680 <param name="analysis_type_selector" value="simple"/>
684 <param name="source" value="history" /> 681 <param name="source" value="history" />
685 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/> 682 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
686 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> 683 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
687 <param name="own_file" value="bowtie2-ref.fasta" /> 684 <param name="own_file" value="bowtie2-ref.fasta" />
688 <param name="save_mapping_stats" value="true" /> 685 <param name="save_mapping_stats" value="true" />
689 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> 686 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
690 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/> 687 <output name="mapping_stats">
688 <assert_contents>
689 <has_text text="of these" />
690 </assert_contents>
691 </output>
692 </test>
693 <test>
694 <!-- basic test on interleaved paired default run -->
695 <param name="type" value="paired_interleaved"/>
696 <!-- <param name="paired_options_selector" value="no"/> -->
697 <param name="unaligned_file" value="false"/>
698 <param name="analysis_type_selector" value="simple"/>
699 <param name="rg_selector" value="set"/>
700 <param name="ID" value="rg1"/>
701 <param name="PL" value="CAPILLARY"/>
702 <param name="source" value="history" />
703 <param name="input_1" value="bowtie2-fq_il.fq" ftype="fastqsanger"/>
704 <param name="own_file" value="bowtie2-ref.fasta" />
705 <output name="output" file="bowtie2-test_il.bam" ftype="bam" lines_diff="2"/>
691 </test> 706 </test>
692 <test> 707 <test>
693 <!-- test fastqsanger.gz input --> 708 <!-- test fastqsanger.gz input -->
694 <param name="type" value="paired"/> 709 <param name="type" value="paired"/>
695 <param name="selection" value="no"/>
696 <param name="paired_options_selector" value="no"/> 710 <param name="paired_options_selector" value="no"/>
697 <param name="unaligned_file" value="false"/> 711 <param name="unaligned_file" value="false"/>
698 <param name="analysis_type_selector" value="simple"/> 712 <param name="analysis_type_selector" value="simple"/>
699 <param name="source" value="history" /> 713 <param name="source" value="history" />
700 <param name="input_1" value="bowtie2-fq1.fq.gz" ftype="fastqsanger.gz"/> 714 <param name="input_1" value="bowtie2-fq1.fq.gz" ftype="fastqsanger.gz"/>
703 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> 717 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
704 </test> 718 </test>
705 <test> 719 <test>
706 <!-- test fastqsanger.bz2 input --> 720 <!-- test fastqsanger.bz2 input -->
707 <param name="type" value="paired"/> 721 <param name="type" value="paired"/>
708 <param name="selection" value="no"/>
709 <param name="paired_options_selector" value="no"/> 722 <param name="paired_options_selector" value="no"/>
710 <param name="unaligned_file" value="false"/> 723 <param name="unaligned_file" value="false"/>
711 <param name="analysis_type_selector" value="simple"/> 724 <param name="analysis_type_selector" value="simple"/>
712 <param name="source" value="history" /> 725 <param name="source" value="history" />
713 <param name="input_1" value="bowtie2-fq1.fq.bz2" ftype="fastqsanger.bz2"/> 726 <param name="input_1" value="bowtie2-fq1.fq.bz2" ftype="fastqsanger.bz2"/>
752 765
753 ----- 766 -----
754 767
755 **Inputs** 768 **Inputs**
756 769
757 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files. 770 Bowtie 2 accepts files in Sanger FASTQ format (single or paired-end). Paired-end data can represented as two individual (forward and reverse) datasets, as well as a single interleaved dataset (see an example at the end of the help section).
758 771
759 ------ 772 ------
760 773
761 **Input options**:: 774 **Input options**::
775
776 --interleaved
777 Reads interleaved FASTQ files where the first two records (8 lines) represent a mate pair.
762 778
763 -s/--skip <int> 779 -s/--skip <int>
764 Skip (i.e. do not align) the first `<int>` reads or pairs in the input. 780 Skip (i.e. do not align) the first `<int>` reads or pairs in the input.
765 781
766 -u/--qupto <int> 782 -u/--qupto <int>
1135 current time. This means that Bowtie 2 will not necessarily report the same 1151 current time. This means that Bowtie 2 will not necessarily report the same
1136 alignment for two identical reads. This is counter-intuitive for some users, 1152 alignment for two identical reads. This is counter-intuitive for some users,
1137 but might be more appropriate in situations where the input consists of many 1153 but might be more appropriate in situations where the input consists of many
1138 identical reads. 1154 identical reads.
1139 1155
1156 -----
1157
1158
1159 **Paired-end (and mate-pair) data in fastq format**
1160
1161 Paired end datasets can be represented as two individual datasets:
1162
1163 First dataset::
1164
1165 @1/1
1166 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
1167 +
1168 EGGEGGGDFGEEEAEECGDEGGFEEGEFGBEEDDECFEFDD@CDD<ED
1169 @2/1
1170 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
1171 +
1172 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG
1173
1174 Second dataset::
1175
1176 @1/2
1177 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
1178 +
1179 GHHHDFDFGFGEGFBGEGGEGEGGGHGFGHFHFHHHHHHHEF?EFEFF
1180 @2/2
1181 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
1182 +
1183 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH
1184
1185 Or a single *interleaved* dataset::
1186
1187 @1/1
1188 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
1189 +
1190 EGGEGGGDFGEEEAEECGDEGGFEEGEFGBEEDDECFEFDD@CDD<ED
1191 @1/2
1192 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
1193 +
1194 GHHHDFDFGFGEGFBGEGGEGEGGGHGFGHFHFHHHHHHHEF?EFEFF
1195 @2/1
1196 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
1197 +
1198 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG
1199 @2/2
1200 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
1201 +
1202 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH
1203
1204
1205
1206
1140 ]]></help> 1207 ]]></help>
1141 <citations> 1208 <citations>
1142 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> 1209 <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
1143 <citation type="doi">10.1038/nmeth.1923</citation> 1210 <citation type="doi">10.1038/nmeth.1923</citation>
1144 </citations> 1211 </citations>