changeset 10:4b83265b2686 draft

Uploaded
author davidvanzessen
date Thu, 26 Mar 2015 10:00:24 -0400
parents 4c4149fa0bcb
children b0242cd1da34
files gene_identification.py
diffstat 1 files changed, 14 insertions(+), 19 deletions(-) [+]
line wrap: on
line diff
--- a/gene_identification.py	Thu Mar 26 08:53:41 2015 -0400
+++ b/gene_identification.py	Thu Mar 26 10:00:24 2015 -0400
@@ -37,10 +37,12 @@
 			dic[ID] = ""
 		else:
 			dic[ID] = linesplt[seqIndex]
+			
+print "Number of input sequences:", len(dic)
 
 #lambda/kappa reference sequence
-searchstrings = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatgggaacgtggtcatcgcctgcctggtccagggcttcttcccccaggagccactcagtgtgacctggagcgaaag",
-                 "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcc",
+searchstrings = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatgggaacgtggtcatcgcctgcctg",
+                 "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgacca",
                  "cm": "gggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccc"}
 
 compiledregex = {"ca": [],
@@ -119,15 +121,6 @@
 			matches = regex.finditer(seq[lastindex:])
 			for match in matches: #for every match with the current regex, only uses the first hit
 				lastindex += match.start()
-				print ID
-				print lastindex
-				print chunklength
-				print i
-				print seq[lastindex:]
-				print start
-				print len(seq)
-				print relativeStartLocation
-				print "-------------------"
 				start[relativeStartLocation] += 1
 				if hasVar: #if the regex has a variable nt in it
 					chunkstart = chunklength / 2 * i #where in the reference does this chunk start
@@ -162,6 +155,7 @@
 
 
 first = True
+seq_write_count=0
 with open(infile, 'r') as f: #read all sequences into a dictionary as key = ID, value = sequence
 	with open(output, 'w') as o:
 		for line in f:
@@ -181,34 +175,35 @@
 			cahits = currentIDHits["ca_hits"]
 			cghits = currentIDHits["cg_hits"]
 			cmhits = currentIDHits["cm_hits"]
-			if cahits > cghits and cahits > cmhits: #its a ca gene
+			if cahits >= cghits and cahits >= cmhits: #its a ca gene
 				ca1hits = currentIDHits["ca1"]
 				ca2hits = currentIDHits["ca2"]
-				if ca1hits > ca2hits:
+				if ca1hits >= ca2hits:
 					o.write(line.rstrip() + "\tca1\t" + str(int(ca1hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n")
 				else:
 					o.write(line.rstrip() + "\tca2\t" + str(int(ca2hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n")
-			elif cghits > cahits and cghits > cmhits: #its a cg gene
+			elif cghits >= cahits and cghits >= cmhits: #its a cg gene
 				cg1hits = currentIDHits["cg1"]
 				cg2hits = currentIDHits["cg2"]
 				cg3hits = currentIDHits["cg3"]
 				cg4hits = currentIDHits["cg4"]
-				if cg1hits > cg2hits and cg1hits > cg3hits and cg1hits > cg4hits: #cg1 gene
+				if cg1hits >= cg2hits and cg1hits >= cg3hits and cg1hits >= cg4hits: #cg1 gene
 					o.write(line.rstrip() + "\tcg1\t" + str(int(cg1hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
-				elif cg2hits > cg1hits and cg2hits > cg3hits and cg2hits > cg4hits: #cg2 gene
+				elif cg2hits >= cg1hits and cg2hits >= cg3hits and cg2hits >= cg4hits: #cg2 gene
 					o.write(line.rstrip() + "\tcg2\t" + str(int(cg2hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
-				elif cg3hits > cg1hits and cg3hits > cg2hits and cg3hits > cg4hits: #cg3 gene
+				elif cg3hits >= cg1hits and cg3hits >= cg2hits and cg3hits >= cg4hits: #cg3 gene
 					o.write(line.rstrip() + "\tcg3\t" + str(int(cg3hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
 				else: #cg4 gene
 					o.write(line.rstrip() + "\tcg4\t" + str(int(cg4hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
 			else: #its a cm gene
 				o.write(line.rstrip() + "\tcm\t0\t" + str(int(cmhits / possiblecm * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
+			seq_write_count += 1
 
 print "Time: %i" % (int(time.time() * 1000) - starttime)
 
+print "Number of sequences written to file:", seq_write_count
+
 
 
 
 
-
-