--- a/igblastn.xml	Wed Aug 20 10:04:09 2014 -0400
+++ b/igblastn.xml	Thu Nov 06 03:31:15 2014 -0500
@@ -1,16 +1,82 @@
 <tool id="igblastn" name="igBLASTn" version="0.1.0">
     <description> </description>
-    <command interpreter="bash">
-		igblastn.sh $input $output
+    <command interpreter="python">
+		igblast_post.py --input $input --output $output
     </command>
     <inputs>
         <param name="input" type="data" format="fasta" label="Fasta file"/>
     </inputs>
     <outputs>
-        <data name="output" format="text" label="${input.name}-igBLASTn Report"/>
+        <data name="output" format="tabular" type="data" label="${input.name}-igBLASTn Report"/>
 	<!--<data name="log" format="text" label="log"/>-->
     </outputs>
+	<requirements>
+		<requirement type="package" version="1.0.0">igBlastn</requirement>
+	</requirements>
     <help>
-        Step 1 of the Immune Repertoire tools, generates a report to be parsed with the "igparse" tool.
+============
+iReport
+============
+
+This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing.
+
+**NOTE**
+
+.. class:: warningmark
+
+- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use.
+
+**USAGE**
+
+.. class:: infomark
+
+- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers.
+
+
+**INPUT**
+
+This tool accepts FASTA files as input:
+
+::
+
+		>lcl|FLN1FA002RWEZA.1| 
+		ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
+		tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
+		gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
+		cag
+		>lcl|FLN1FA001BLION.1| 
+		aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat
+		taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg
+		cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag
+
+**OUTPUT**
+
+The following data is used for ARGalaxy
+
++-----------------+----------------------------------------------+
+| Column name     | Column contents                              |
++-----------------+----------------------------------------------+
+| ID              | The Sequence ID provided by the sequencer.   |
++-----------------+----------------------------------------------+
+| VDJ Frame       | In-frame/Out-frame                           |
++-----------------+----------------------------------------------+
+| Top V Gene      | The best matching V gene found.              |
++-----------------+----------------------------------------------+
+| Top D Gene      | The best matching D gene found.              |
++-----------------+----------------------------------------------+
+| Top J Gene      | The best matching J gene found.              |
++-----------------+----------------------------------------------+
+| CDR3 Seq        | The CDR3 region.                             |
++-----------------+----------------------------------------------+
+| CDR3 Length     | The length of the CDR3 region.               |
++-----------------+----------------------------------------------+
+| CDR3 Seq DNA    | The CDR3 sequence region.                    |
++-----------------+----------------------------------------------+
+| CDR3 Length DNA | The length of the CDR3 sequence region.      |
++-----------------+----------------------------------------------+
+| Functionality   | If sequence is productive/unproductive       |
++-----------------+----------------------------------------------+
+
+
     </help>
 </tool>