Mercurial > repos > davidvanzessen > argalaxy_tools
diff igblastn.xml @ 3:c7c7000de220 draft
Uploaded
| author | davidvanzessen |
|---|---|
| date | Thu, 30 Jul 2015 09:31:38 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/igblastn.xml Thu Jul 30 09:31:38 2015 -0400 @@ -0,0 +1,98 @@ +<tool id="igblastn" name="igBLASTn" version="0.1.0"> + <description> </description> + <command interpreter="bash"> + igblast/igblast.sh $input $species $locus $output + </command> + <inputs> + <param name="input" type="data" format="fasta" label="Fasta file"/> + <param name="species" type="select" label="Species"> + <option value="human">Homo sapiens</option> + <option value="mouse">Mus musculus</option> + <option value="rat">Rattus norvegicus</option> + <option value="rabbit">Oryctolagus cuniculus</option> + <option value="rhesus_monkey">Macaca mulatta</option> + </param> + <param name="locus" type="select" label="Locus"> + <option value="TRA">TRA</option> + <option value="TRB">TRB</option> + <option value="TRG">TRG</option> + <option value="TRD">TRD</option> + <option value="IGH">IGH</option> + <option value="IGK">IGK</option> + <option value="IGL">IGL</option> + </param> + </inputs> + <outputs> + <data name="output" format="tabular" type="data" label="${input.name}-igBLASTn aligned"/> + <!--<data name="log" format="text" label="log"/>--> + </outputs> + <requirements> + <requirement type="package" version="0.6">igblastwrp</requirement> + </requirements> + <help> +============ +iReport +============ + +This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing. + +**NOTE** + +.. class:: warningmark + +- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use. + +**USAGE** + +.. class:: infomark + +- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers. + + +**INPUT** + +This tool accepts FASTA files as input: + +:: + + >lcl|FLN1FA002RWEZA.1| + ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc + tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc + gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct + cag + >lcl|FLN1FA001BLION.1| + aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat + taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg + cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag + +**OUTPUT** + +The following data is used for ARGalaxy + ++-----------------+----------------------------------------------+ +| Column name | Column contents | ++-----------------+----------------------------------------------+ +| ID | The Sequence ID provided by the sequencer. | ++-----------------+----------------------------------------------+ +| VDJ Frame | In-frame/Out-frame | ++-----------------+----------------------------------------------+ +| Top V Gene | The best matching V gene found. | ++-----------------+----------------------------------------------+ +| Top D Gene | The best matching D gene found. | ++-----------------+----------------------------------------------+ +| Top J Gene | The best matching J gene found. | ++-----------------+----------------------------------------------+ +| CDR3 Seq | The CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Length | The length of the CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Seq DNA | The CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| CDR3 Length DNA | The length of the CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| Functionality | If sequence is productive/unproductive | ++-----------------+----------------------------------------------+ + + + </help> +</tool>
