Mercurial > repos > bgruening > sklearn_data_preprocess
annotate test-data/RF01704.fasta @ 26:55b36adb2dc7 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/sklearn commit c0a3a186966888e5787335a7628bf0a4382637e7
| author | bgruening |
|---|---|
| date | Tue, 14 May 2019 17:51:16 -0400 |
| parents | 12b2bef577d0 |
| children |
| rev | line source |
|---|---|
|
0
12b2bef577d0
planemo upload for repository https://github.com/bgruening/galaxytools/tools/sklearn commit a349cb4673231f12344e418513a08691925565d9
bgruening
parents:
diff
changeset
|
1 >CP000097.1/1411351-1411410 |
|
12b2bef577d0
planemo upload for repository https://github.com/bgruening/galaxytools/tools/sklearn commit a349cb4673231f12344e418513a08691925565d9
bgruening
parents:
diff
changeset
|
2 CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA |
|
12b2bef577d0
planemo upload for repository https://github.com/bgruening/galaxytools/tools/sklearn commit a349cb4673231f12344e418513a08691925565d9
bgruening
parents:
diff
changeset
|
3 >ACNY01000002.1/278641-278580 |
|
12b2bef577d0
planemo upload for repository https://github.com/bgruening/galaxytools/tools/sklearn commit a349cb4673231f12344e418513a08691925565d9
bgruening
parents:
diff
changeset
|
4 GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG |
