diff test-data/structure1.ps @ 0:5fba0aafe8f1 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tools/GraphClust/AlignCluster commit 4406735e44aba20859c252be39f4e99df28c7a92
author bgruening
date Sat, 27 Oct 2018 13:09:04 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/structure1.ps	Sat Oct 27 13:09:04 2018 -0400
@@ -0,0 +1,352 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Sat Oct 27 14:38:56 2018
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: --noLP 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  72 216 translate
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  72 6 mul size div dup scale
+  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+  translate
+} bind def
+end
+RNAplot begin
+% extra definitions for standard anotations
+/min { 2 copy gt { exch } if pop } bind def
+/BLACK { 0 0 0 } def
+/RED   { 1 0 0 } def
+/GREEN { 0 1 0 } def
+/BLUE  { 0 0 1 } def
+/WHITE { 1 1 1 } def
+/LabelFont { % font size LabelFont
+  exch findfont exch fsize mul scalefont setfont
+} bind def
+/Label { % i dx dy (text) Label
+  % write text at base i plus offset dx, dy
+  4 3 roll 1 sub coor exch get aload pop moveto
+  3 1 roll fsize mul exch fsize mul exch rmoveto
+  show
+} bind def
+/cmark { % i cmark   draw circle around base i
+  newpath 1 sub coor exch get aload pop
+  fsize 2 div 0 360 arc stroke
+} bind def
+/gmark { % i j c gmark
+  % draw basepair i,j with c counter examples in gray
+  gsave
+  3 min [0 0.33 0.66 0.9] exch get setgray
+  1 sub dup coor exch get aload pop moveto
+  sequence exch 1 getinterval cshow
+  1 sub dup coor exch get aload pop moveto
+  sequence exch 1 getinterval cshow
+  grestore
+} bind def
+/segmark { % f i j lw r g b segmark
+  % mark segment [i,j] with outline width lw and color rgb
+  % use omark and Fomark instead
+  gsave
+  setrgbcolor setlinewidth
+  newpath
+  1 sub exch 1 sub dup
+  coor exch get aload pop moveto
+  currentdict (cpr) known
+  {
+    3 -1 roll dup 4 1 roll dup
+    {
+      3 1 roll dup 3 -1 roll dup
+      4 1 roll exch 5 2 roll exch
+    }
+    {
+      3 1 roll exch
+    } ifelse
+    1 exch { coor exch get aload pop lineto } for
+    {
+      dup 3 1 roll 1 add exch 1 add arccoords pop pop
+      4 2 roll 5 -1 roll coor exch get aload pop curveto
+    } if
+  }
+  {
+    exch 1 exch {
+      coor exch get aload pop lineto
+    } for
+  } ifelse
+  { closepath fill } if  stroke
+  grestore
+} bind def
+/omark { % i j lw r g b omark
+  % stroke segment [i..j] with linewidth lw, color rgb
+  false 7 1 roll segmark
+} bind def
+/Fomark { % i j r g b Fomark
+  % fill segment [i..j] with color rgb
+  % should precede drawbases
+  1 4 1 roll true 7 1 roll segmark
+} bind def
+/BFmark{ % i j k l r g b BFmark
+  % fill block between pairs (i,j) and (k,l) with color rgb
+  % should precede drawbases
+  gsave
+  setrgbcolor
+  newpath
+  currentdict (cpr) known
+  {
+    dup 1 sub coor exch get aload pop moveto % move to l
+    dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch
+    { coor exch get aload pop lineto } for % lines from l to j
+    3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i
+    exch dup 4 -1 roll 1 sub exch 1 sub 1 exch
+    { coor exch get aload pop lineto } for % lines from i to k
+    exch arccoords curveto% curve from k to l
+  }
+  {  exch 4 3 roll exch 1 sub exch 1 sub dup
+     coor exch get aload pop moveto
+     exch 1 exch { coor exch get aload pop lineto } for
+     exch 1 sub exch 1 sub dup
+     coor exch get aload pop lineto
+     exch 1 exch { coor exch get aload pop lineto } for
+  } ifelse
+    closepath fill stroke
+   grestore
+} bind def
+/hsb {
+  dup 0.3 mul 1 exch sub sethsbcolor
+} bind def
+/colorpair { % i j hue sat colorpair
+  % draw basepair i,j in color
+  % 1 index 0.00 ne {
+  gsave
+  newpath
+  hsb
+  fsize setlinewidth
+  currentdict (cpr) known
+  {
+    exch dup
+    coor  exch 1 sub get aload pop moveto
+    exch arccoords curveto
+  }
+  { 1 sub coor exch get aload pop moveto
+    1 sub coor exch get aload pop lineto
+  } ifelse
+   stroke
+   grestore
+   % } if
+} bind def
+end
+
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+AUGAAUAUAGUUUAAA_UAGAACAUUAGAUUUUCAAACUAAUAGUAGAGGC\
+) def
+/coor [
+[95.00124359 138.88397217]
+[87.89935303 137.28974915]
+[81.21456146 134.41014099]
+[75.17730713 130.34443665]
+[69.99568176 125.23274994]
+[65.84830475 119.25129700]
+[62.87813568 112.60626221]
+[61.18754959 105.52667999]
+[60.83482361 98.25659943]
+[61.83211517 91.04661560]
+[48.15361786 84.89042664]
+[34.47511673 78.73423004]
+[20.79662132 72.57804108]
+[6.11008787 78.41596222]
+[-8.36961174 72.08241272]
+[-14.05193043 57.33497620]
+[-7.56564760 42.92304993]
+[7.24103928 37.39696503]
+[21.58358574 44.03525925]
+[26.95281219 58.89954376]
+[40.63130951 65.05573273]
+[54.30980682 71.21192932]
+[67.98830414 77.36811829]
+[94.10119629 61.24235916]
+[123.82917786 68.86929321]
+[135.05683899 58.92245483]
+[146.28450012 48.97561264]
+[157.51216125 39.02877426]
+[168.73982239 29.08193398]
+[168.13914490 13.45589161]
+[177.76402283 1.13129318]
+[193.06988525 -2.07256317]
+[206.82977295 5.35708570]
+[212.54667664 19.91218758]
+[207.52125549 34.72026825]
+[194.12637329 42.78940201]
+[178.68666077 40.30959702]
+[167.45899963 50.25643539]
+[156.23133850 60.20327377]
+[145.00367737 70.15011597]
+[133.77601624 80.09695435]
+[136.87315369 86.68378448]
+[138.69926453 93.72961426]
+[139.19142151 100.99159241]
+[138.33265686 108.21938324]
+[136.15257263 115.16385651]
+[132.72630310 121.58563232]
+[128.17196655 127.26335907]
+[122.64655304 132.00131226]
+[116.34051514 135.63619995]
+[109.47121429 138.04269409]
+] def
+/pairs [
+[10 23]
+[11 22]
+[12 21]
+[13 20]
+[25 41]
+[26 40]
+[27 39]
+[28 38]
+[29 37]
+] def
+
+init
+
+% Start Annotations
+10 23 0.16 1 colorpair
+11 22 0.16 1 colorpair
+12 21 0.16 1 colorpair
+13 20 0.48 1 colorpair
+25 41 0.32 1 colorpair
+26 40 0.32 1 colorpair
+27 39 0.32 1 colorpair
+28 38 0.48 1 colorpair
+29 37 0.32 1 colorpair
+
+% End Annotations
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% Start Annotations
+23 cmark
+11 cmark
+22 cmark
+12 cmark
+21 cmark
+13 cmark
+20 cmark
+25 cmark
+41 cmark
+26 cmark
+40 cmark
+27 cmark
+39 cmark
+28 cmark
+38 cmark
+29 cmark
+37 cmark
+
+% End Annotations
+% show it
+showpage
+end
+%%EOF