diff dotknot.xml @ 0:7d7194e4a205 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna/dotknot commit 6def0606119579a9adbc09c171b87a2bcac7236d-dirty
author bgruening
date Thu, 17 Sep 2015 12:53:41 -0400
parents
children 12fd4ac417fe
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/dotknot.xml	Thu Sep 17 12:53:41 2015 -0400
@@ -0,0 +1,139 @@
+<tool id="dotknot" name="DotKnot" version="1.3.1">
+    <description>pseudoknot prediction in a given RNA sequence</description>
+    <requirements>
+        <requirement type="package" version="1.8.5">vienna_rna</requirement>
+        <requirement type="package" version="1.3.1">dotknot</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" />
+        <exit_code range=":-1" />
+        <regex match="Error:" />
+        <regex match="Exception:" />
+    </stdio>
+    <version_command>dotknot version 1.3.1</version_command>
+    <command><![CDATA[
+        dotknot.py
+        $input
+        $k
+        $l
+        $g
+        > ./output.txt
+        #if $g:
+            &&
+            mv ./*.ct ./globalstructure.ct
+        #end if
+    ]]></command>
+    <inputs>
+        <param name="input" type="data" format="fasta" label="Upload your FASTA file with RNA sequences:"
+            help="The FASTA file must contain a comment line starting with > followed by the sequence.
+                It can also contain several consecutive sequences and DotKnot will be executed for each sequence in the file."/>
+
+        <param argument="-k" type="boolean" checked="false"
+            truevalue="-k" falsevalue=""
+            label="Include kissing hairpins?"
+            help="Kissing hairpins are complex and biologically relevant types of pseudoknots.
+                Inclusion of kissing hairpins will lead to increased run time,
+                yet produce more meaningful results."/>
+
+        <param argument="-l" type="boolean" checked="false"
+            truevalue="-l" falsevalue=""
+            label="Include near-optimal local pseudoknots?"
+            help="Shows top five near-optimal local pseudoknots in terms of two criteria: 
+                estimated free energy to length ratio and lowest estimated free energy.
+                This can help to identify promising pseudoknot foldings and may
+                compensate for the limitations of the energy parameters."/>
+                
+         <param argument="-g" type="boolean" checked="false"
+            truevalue="-g" falsevalue=""
+            label="Include global structure?"
+            help="Shows predicted global structure in addition to predicted pseudoknots."/>
+
+    </inputs>
+    <outputs>
+            <data name="output" format="txt" from_work_dir="./output.txt" 
+                label="${tool.name} on ${on_string} (output file)">
+            </data>
+            <data name="outfile_globalstructure" format="txt" from_work_dir="./globalstructure.ct" 
+                label="${tool.name} on ${on_string} (output global structure)">
+                <filter>g == True</filter>
+            </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="TMV.fasta" ftype="fasta"/>
+            <param name="k" value=""/>
+            <param name="l" value=""/>
+            <param name="g" value=""/>
+            <output name="output" file="test1_output.txt" ftype="txt"/>
+        </test>
+        <test>
+            <param name="input" value="HCoV229E_short_KISSINGHAIRPINS.fasta" ftype="fasta"/>
+            <param name="k" value="-k"/>
+            <param name="l" value="-l"/>
+            <param name="g" value="-g"/>
+            <output name="output" file="test2_output.txt" ftype="txt"/>
+            <output name="outfile_globalstructure" file="test2_output2.ct" ftype="txt"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+**WHAT IT DOES**
+
+DotKnot is a heuristic method for pseudoknot prediction in a given RNA sequence.
+
+DotKnot extracts stem regions from the secondary structure probability dot plot calculated by RNAfold. Recursive H-type pseudoknots and intramolecular kissing hairpins are constructed and their presence in the sequence is verified. The detected pseudoknots can then be further analysed using bioinformatics or laboratory techniques.
+
+-----
+
+**INPUT**
+
+The FASTA file must contain a comment line starting with > followed by the sequence. It can also
+contain several consecutive sequences and DotKnot will be executed for each sequence in the file.
+
+Please ensure that only bases A,C,G,U,T (a,c,g,u,t) are used.
+
+*Example*::
+
+    > Arc-Ful-SRP short
+        GGGGGGUUCGGCGUCCCCUGUAACCCGAAACCGCCGAUACGCGGG
+    > MMTV
+        AAAAAACUUGUAAAGGGGCAGUCCCCUAGCCCCGCUCAAAAGGGGGAUG
+        
+-----
+
+**OPTIONAL ARGUMENTS**
+
+*Kissing hairpins*::
+    Kissing hairpins are complex and biologically relevant types of pseudoknots.
+    Inclusion of kissing hairpins will lead to increased run time, yet produce more meaningful
+    results.
+    
+*local pseudoknots*:: 
+    Shows top five near-optimal local pseudoknots in terms of two criteria: estimated free energy
+    to length ratio and lowest estimated free energy. This can help to identify promising pseudoknot
+    foldings and may compensate for the limitations of the energy parameters.
+*global structure*:: 
+    Shows predicted global structure in addition to predicted pseudoknots
+
+-----
+
+**OUTPUT**
+
+Each pseudoknot is displayed in dot-bracket notation. Unpaired bases are indicated by dots. Base
+pairs are written as bracket pairs. The first stem of a pseudoknot is indicated by round brackets , i.e. ( and ). The second stem of a pseudoknot is indicated by square brackets, i.e. [ and ]. 
+
+We also give the start and end positions of the pseudoknot with respect to the input sequence. If the global structure option is chosen (-g:), a CT file will be created which contains the global
+structure. The file name will start with the identifier given in the FASTA file.
+
+-----
+
+**dotknot** is a Free and Open Source Software, see more details and background information on the dotknot dotknot_ Website.
+
+.. _dotknot: http://dotknot.csse.uwa.edu.au/
+
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1093/nar/gkq021</citation>
+        <citation type="doi">10.1261/rna.2394511</citation>
+    </citations>
+</tool>