Mercurial > repos > bebatut > prinseq
comparison prinseq.xml @ 0:65f03479b3ba draft
planemo upload for repository https://github.com/ASaiM/galaxytools/tree/master/tools/prinseq/ commit 60b4516b1882c91adf8041a586c0a17738f38dbc-dirty
author | bebatut |
---|---|
date | Tue, 27 Oct 2015 12:43:37 -0400 |
parents | |
children | 6912790a4287 |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:65f03479b3ba |
---|---|
1 <tool id="prinseq" name="PRINSEQ" version="0.1.0"> | |
2 <description>to process quality of sequences</description> | |
3 | |
4 <requirements> | |
5 <requirement type="package" version="0.20.4">prinseq</requirement> | |
6 </requirements> | |
7 | |
8 <stdio> | |
9 <exit_code range="1:" level="fatal" description="" /> | |
10 <regex match="ERROR" | |
11 source="stderr" | |
12 level="fatal" | |
13 description="" /> | |
14 <regex match="WARNING" | |
15 source="stderr" | |
16 level="warning" | |
17 description="" /> | |
18 </stdio> | |
19 | |
20 <command><![CDATA[ | |
21 perl prinseq-lite.pl | |
22 -fastq $input_sequence_file | |
23 -out_good stdout | |
24 -out_bad null | |
25 | |
26 #if $filter_treatments.apply_filter_treatments : | |
27 #set length_filter_treatments=$filter_treatments.length_filter_treatments | |
28 #if $length_filter_treatments.apply_length_filter_treatments : | |
29 #set min_length_filter_treatments=$length_filter_treatments.min_length_filter_treatments | |
30 #if $min_length_filter_treatments.apply_min_length_filter_treatments : | |
31 -min_len $min_length_filter_treatments.value | |
32 #end if | |
33 #set max_length_filter_treatments=$length_filter_treatments.max_length_filter_treatments | |
34 #if $max_length_filter_treatments.apply_max_length_filter_treatments : | |
35 -max_len $min_length_filter_treatments.value | |
36 #end if | |
37 #end if | |
38 | |
39 #set quality_filter_treatments=$filter_treatments.quality_filter_treatments | |
40 #if $quality_filter_treatments.apply_quality_filter_treatments: | |
41 #set min_quality_filter_treatments=$quality_filter_treatments.min_quality_filter_treatments | |
42 #if $min_quality_filter_treatments.apply_min_quality_filter_treatments : | |
43 -min_qual_score $min_quality_filter_treatments.value | |
44 #end if | |
45 #set max_quality_filter_treatments=$quality_filter_treatments.max_quality_filter_treatments | |
46 #if $max_quality_filter_treatments.apply_max_quality_filter_treatments : | |
47 -max_qual_score $max_quality_filter_treatments.value | |
48 #end if | |
49 #set mean_quality_filter_treatments=$quality_filter_treatments.mean_quality_filter_treatments | |
50 #if $mean_quality_filter_treatments.apply_mean_quality_filter_treatments: | |
51 #set min_mean_quality_filter_treatments=$mean_quality_filter_treatments.min_mean_quality_filter_treatments | |
52 #if $min_mean_quality_filter_treatments.apply_min_mean_quality_filter_treatments: | |
53 -min_qual_mean $min_mean_quality_filter_treatments.value | |
54 #end if | |
55 #set max_mean_quality_filter_treatments=$mean_quality_filter_treatments.max_mean_quality_filter_treatments | |
56 #if $max_mean_quality_filter_treatments.apply_max_mean_quality_filter_treatments: | |
57 -max_qual_mean $max_mean_quality_filter_treatments.value | |
58 #end if | |
59 #end if | |
60 #end if | |
61 | |
62 #set base_content_filter_treatments=$filter_treatments.base_content_filter_treatments | |
63 #if $base_content_filter_treatments.apply_base_content_filter_treatments : | |
64 #set GC_perc_content_filter_treatments=$base_content_filter_treatments.GC_perc_content_filter_treatments | |
65 #if $GC_perc_content_filter_treatments.apply_GC_perc_content_filter_treatments : | |
66 #set min_GC_perc_content_filter_treatments=$GC_perc_content_filter_treatments.min_GC_perc_content_filter_treatments | |
67 #if $min_GC_perc_content_filter_treatments.apply_min_GC_perc_content_filter_treatments : | |
68 -min_gc $min_GC_perc_content_filter_treatments.value | |
69 #end if | |
70 set max_GC_perc_content_filter_treatments=$GC_perc_content_filter_treatments.max_GC_perc_content_filter_treatments | |
71 #if $max_GC_perc_content_filter_treatments.apply_max_GC_perc_content_filter_treatments : | |
72 -max_gc $max_GC_perc_content_filter_treatments.value | |
73 #end if | |
74 #end if | |
75 #set N_number_content_filter_treatments=$base_content_filter_treatments.N_number_content_filter_treatments | |
76 #if $N_number_content_filter_treatments.apply_N_number_content_filter_treatments : | |
77 -ns_max_n $N_number_content_filter_treatments.value | |
78 #end if | |
79 #set N_percentage_content_filter_treatments=$base_content_filter_treatments.N_percentage_content_filter_treatments | |
80 #if $N_percentage_content_filter_treatments.apply_N_percentage_content_filter_treatments : | |
81 -ns_max_p $N_percentage_content_filter_treatments.value | |
82 #end if | |
83 #if $base_content_filter_treatments.apply_other_base_content_filter_treatments : | |
84 -noniupac | |
85 #end if | |
86 #end if | |
87 | |
88 #set complexity_filter_treatments=$filter_treatments.complexity_filter_treatments | |
89 #if $complexity_filter_treatments.apply_complexity_filter_treatments : | |
90 -lc_method $complexity_filter_treatments.method_complexity_filter_treatments | |
91 -lc_threshold $complexity_filter_treatments.threshold_complexity_filter_treatments | |
92 #end if | |
93 | |
94 #end if | |
95 | |
96 #if $trimming_treatments.apply_trimming_treatments : | |
97 #set length_trimming_treatments=$trimming_treatments.length_trimming_treatments | |
98 #if $length_trimming_treatments.apply_length_trimming_treatments : | |
99 -trim_to_len $length_trimming_treatments.value | |
100 #end if | |
101 | |
102 #set position_trimming_treatments=$trimming_treatments.position_trimming_treatments | |
103 #if $position_trimming_treatments.apply_position_trimming_treatments : | |
104 #set nb_position_trimming_treatments=$position_trimming_treatments.nb_position_trimming_treatments | |
105 #if $nb_position_trimming_treatments.apply_nb_position_trimming_treatments : | |
106 #set left_position_trimming_treatments=$nb_position_trimming_treatments.left_position_trimming_treatments | |
107 #if $left_position_trimming_treatments.apply_left_position_trimming_treatments : | |
108 -trim_left $left_position_trimming_treatments.value | |
109 #end if | |
110 #set right_position_trimming_treatments=$nb_position_trimming_treatments.right_position_trimming_treatments | |
111 #if $right_position_trimming_treatments.apply_right_position_trimming_treatments : | |
112 -trim_right $right_position_trimming_treatments.value | |
113 #end if | |
114 #end if | |
115 #set percentage_position_trimming_treatments=$position_trimming_treatments.percentage_position_trimming_treatments | |
116 #if $percentage_position_trimming_treatments.apply_percentage_position_trimming_treatments : | |
117 #set left_percentage_position_trimming_treatments=$percentage_position_trimming_treatments.left_percentage_position_trimming_treatments | |
118 #if $left_percentage_position_trimming_treatments.apply_left_percentage_position_trimming_treatments : | |
119 -trim_left_p $left_percentage_position_trimming_treatments.value | |
120 #end if | |
121 #set right_percentage_position_trimming_treatments=$percentage_position_trimming_treatments.right_percentage_position_trimming_treatments | |
122 #if $right_percentage_position_trimming_treatments.apply_right_percentage_position_trimming_treatments : | |
123 -trim_right_p $right_percentage_position_trimming_treatments.value | |
124 #end if | |
125 #end if | |
126 #end if | |
127 | |
128 #set tail_trimming_treatments=$trimming_treatments.tail_trimming_treatments | |
129 #if $tail_trimming_treatments.apply_tail_trimming_treatments : | |
130 #set a_t_tail_trimming_treatments=$tail_trimming_treatments.a_t_tail_trimming_treatments | |
131 #if $a_t_tail_trimming_treatments.apply_a_t_tail_trimming_treatments : | |
132 #set left_a_t_tail_trimming_treatments=$a_t_tail_trimming_treatments.left_a_t_tail_trimming_treatments | |
133 #if $left_a_t_tail_trimming_treatments.apply_left_a_t_tail_trimming_treatments : | |
134 -trim_tail_left $left_a_t_tail_trimming_treatments.value | |
135 #end if | |
136 #set right_a_t_tail_trimming_treatments=$a_t_tail_trimming_treatments.right_a_t_tail_trimming_treatments | |
137 #if right_a_t_tail_trimming_treatments.apply_right_a_t_tail_trimming_treatments : | |
138 -trim_tail_right $right_a_t_tail_trimming_treatments.value | |
139 #end if | |
140 #end if | |
141 #set ns_tail_trimming_treatments=$tail_trimming_treatments.ns_tail_trimming_treatments | |
142 #if $ns_tail_trimming_treatments.apply_ns_tail_trimming_treatments : | |
143 #set left_ns_tail_trimming_treatments=$ns_tail_trimming_treatments.left_ns_tail_trimming_treatments | |
144 #if $left_ns_tail_trimming_treatments.apply_left_ns_tail_trimming_treatments : | |
145 -trim_ns_left $left_ns_tail_trimming_treatments.value | |
146 #end if | |
147 #set right_ns_tail_trimming_treatments=$ns_tail_trimming_treatments.right_ns_tail_trimming_treatments | |
148 #if $right_ns_tail_trimming_treatments.apply_right_ns_tail_trimming_treatments : | |
149 -trim_ns_right $right_ns_tail_trimming_treatments.value | |
150 #end if | |
151 #end if | |
152 #end if | |
153 | |
154 #set quality_trimming_treatments=$trimming_treatments.quality_trimming_treatments | |
155 #if $quality_trimming_treatments.apply_quality_trimming_treatments : | |
156 #set left_quality_trimming_treatments=$quality_trimming_treatments.left_quality_trimming_treatments | |
157 #if $left_quality_trimming_treatments.apply_left_quality_trimming_treatments : | |
158 -trim_qual_left $left_quality_trimming_treatments.value | |
159 #end if | |
160 #set right_quality_trimming_treatments=$quality_trimming_treatments.right_quality_trimming_treatments | |
161 #if $right_quality_trimming_treatments.apply_right_quality_trimming_treatments : | |
162 -trim_qual_right $right_quality_trimming_treatments.value | |
163 #end if | |
164 -trim_qual_type $quality_trimming_treatments.type_quality_trimming_treatments | |
165 -trim_qual_rule $quality_trimming_treatments.rule_quality_trimming_treatments | |
166 -trim_qual_window $quality_trimming_treatments.window_quality_trimming_treatments | |
167 -trim_qual_step $quality_trimming_treatments.step_quality_trimming_treatments | |
168 #end if | |
169 | |
170 #end if | |
171 | |
172 >> $good_sequence_file | |
173 ]]> | |
174 </command> | |
175 | |
176 <inputs> | |
177 <param name="input_sequence_file" type="data" format="fastq" label="Input sequence file" help="The file must be in fastq format for quality scores"/> | |
178 | |
179 <conditional name="filter_treatments"> | |
180 <param name='apply_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Apply filter treatments?" help=""/> | |
181 <when value="yes"> | |
182 <conditional name="length_filter_treatments"> | |
183 <param name='apply_length_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Filter sequence based on their length?" help="By default, sequences smaller than 60 bp are removed. No top threshold is defined"/> | |
184 <when value="yes"> | |
185 <conditional name="min_length_filter_treatments"> | |
186 <param name='apply_min_length_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Filter too small sequences?" help="By default, sequences smaller than 60 bp are removed."/> | |
187 <when value="yes"> | |
188 <param name="value" type="integer" min="0" max="3000" value="60" label="Minimum length threshold to conserve sequences" help=""/> | |
189 </when> | |
190 </conditional> | |
191 <conditional name="max_length_filter_treatments"> | |
192 <param name='apply_max_length_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter too big sequences?" help="By default, no treatment based on a maximal length is made"/> | |
193 <when value="yes"> | |
194 <param name="value" type="integer" min="0" max="3000" value="1000" label="Maximal length threshold to conserve sequences" help=""/> | |
195 </when> | |
196 </conditional> | |
197 </when> | |
198 </conditional> | |
199 <conditional name="quality_filter_treatments"> | |
200 <param name='apply_quality_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Filter sequences based on quality score?" help="By default, sequences with a mean score below 15 are removed."/> | |
201 <when value="yes"> | |
202 <conditional name="min_quality_filter_treatments"> | |
203 <param name='apply_min_quality_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences based on their minimum score?" help="By default, no treatment based on a minimum score is made"/> | |
204 <when value="yes"> | |
205 <param name="value" type="integer" min="0" max="40" value="2" label="Minimum score threshold to conserve sequences" help=""/> | |
206 </when> | |
207 </conditional> | |
208 <conditional name="max_quality_filter_treatments"> | |
209 <param name='apply_max_quality_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences based on their maximum score?" help="By default, no treatment based on a maximum score is made"/> | |
210 <when value="yes"> | |
211 <param name="value" type="integer" min="0" max="40" value="38" label="Maximum score threshold to conserve sequences" help=""/> | |
212 </when> | |
213 </conditional> | |
214 <conditional name="mean_quality_filter_treatments"> | |
215 <param name='apply_mean_quality_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Filter sequences based on their mean score?" help="By default, sequences with a mean score below 15 are removed."/> | |
216 <when value="yes"> | |
217 <conditional name="min_mean_quality_filter_treatments"> | |
218 <param name='apply_min_mean_quality_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Filter sequences with too small mean score?" help="By default, sequences with a mean score below 15 are removed."/> | |
219 <when value="yes"> | |
220 <param name="value" type="integer" min="0" max="40" value="15" label="Minimum mean score threshold to conserve sequences" help=""/> | |
221 </when> | |
222 </conditional> | |
223 <conditional name="max_mean_quality_filter_treatments"> | |
224 <param name='apply_max_mean_quality_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences with too high mean score?" help="By default, no treatment based on a maximum mean score is made"/> | |
225 <when value="yes"> | |
226 <param name="value" type="integer" min="0" max="40" value="40" label="Maximum mean score threshold to conserve sequences" help=""/> | |
227 </when> | |
228 </conditional> | |
229 </when> | |
230 </conditional> | |
231 </when> | |
232 </conditional> | |
233 <conditional name="base_content_filter_treatments"> | |
234 <param name='apply_base_content_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Filter sequences based on their base content?" help="By default, sequences with more than 2% of N bases are removed."/> | |
235 <when value="yes"> | |
236 <conditional name="GC_perc_content_filter_treatments"> | |
237 <param name='apply_GC_perc_content_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences based on their GC percentage?" help="By default, no treatment based on GC percentage is made."/> | |
238 <when value="yes"> | |
239 <conditional name="min_GC_perc_content_filter_treatments"> | |
240 <param name='apply_min_GC_perc_content_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences with too small GC percentage?" help="By default, no treatment based on GC percentage is made."/> | |
241 <when value="yes"> | |
242 <param name="value" type="integer" min="0" max="100" value="10" label="Minimal GC percentage threshold to conserve sequences" help=""/> | |
243 </when> | |
244 </conditional> | |
245 <conditional name="max_GC_perc_content_filter_treatments"> | |
246 <param name='apply_max_GC_perc_content_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences with too high GC percentage?" help="By default, no treatment based on GC percentage is made."/> | |
247 <when value="yes"> | |
248 <param name="value" type="integer" min="0" max="100" value="90" label="Maximal GC percentage threshold to conserve sequences" help=""/> | |
249 </when> | |
250 </conditional> | |
251 </when> | |
252 </conditional> | |
253 <conditional name="N_number_content_filter_treatments"> | |
254 <param name='apply_N_number_content_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences based on their number of N bases?" help="By default, no treatment based on N number is made."/> | |
255 <when value="yes"> | |
256 <param name="value" type="integer" min="0" max="3000" value="10" label="Maximal N number threshold to conserve sequences" help=""/> | |
257 </when> | |
258 </conditional> | |
259 <conditional name="N_percentage_content_filter_treatments"> | |
260 <param name='apply_N_percentage_content_filter_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Filter sequences based on their percentage of N bases?" help="By default, sequences with more than 2% of N bases are removed."/> | |
261 <when value="yes"> | |
262 <param name="value" type="integer" min="0" max="100" value="2" label="Maximal N percentage threshold to conserve sequences" help=""/> | |
263 </when> | |
264 </conditional> | |
265 <param name='apply_other_base_content_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences with characters other than A, T, C, G and N?" help="By default, this treatment is not made."/> | |
266 </when> | |
267 </conditional> | |
268 <conditional name="complexity_filter_treatments"> | |
269 <param name='apply_complexity_filter_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Filter sequences based on their complexity?" help="By default, no complexity filter is applied"/> | |
270 <when value="yes"> | |
271 <param name="method_complexity_filter_treatments" type="select" display="radio" label="Method to filter low complexity sequences" help=""> | |
272 <option value="dust">Dust</option> | |
273 <option value="entropy" >Entropy</option> | |
274 </param> | |
275 <param name="threshold_complexity_filter_treatments" type="integer" min="0" max="100" value="2" label="Threshold value used to filter sequences by sequence complexity" help="The dust method uses the threshold as maximum allowed score and the entropy method as minimum allowed value."/> | |
276 </when> | |
277 </conditional> | |
278 </when> | |
279 </conditional> | |
280 | |
281 <conditional name="trimming_treatments"> | |
282 <param name='apply_trimming_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Apply trimming treatments?" help=""/> | |
283 <when value="yes"> | |
284 <conditional name="length_trimming_treatments"> | |
285 <param name='apply_length_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim all sequences from the 3'-end to a length?" help="By default, no length trimming is made"/> | |
286 <when value="yes"> | |
287 <param name="value" type="integer" min="0" max="3000" value="100" label="Length of sequences after trimming" help=""/> | |
288 </when> | |
289 </conditional> | |
290 <conditional name="position_trimming_treatments"> | |
291 <param name='apply_position_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim all sequences from the ends?" help="By default, no position trimming is made"/> | |
292 <when value="yes"> | |
293 <conditional name="nb_position_trimming_treatments"> | |
294 <param name='apply_nb_position_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim sequences by a defined number of positions?" help="By default, no position trimming is made"/> | |
295 <when value="yes"> | |
296 <conditional name="left_position_trimming_treatments"> | |
297 <param name='apply_left_position_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim sequences at the 5'-end by a defined number of positions?" help="By default, no position trimming is made"/> | |
298 <when value="yes"> | |
299 <param name="value" type="integer" min="0" max="3000" value="100" label="Number of positions to trim on 5'-end" help=""/> | |
300 </when> | |
301 </conditional> | |
302 <conditional name="right_position_trimming_treatments"> | |
303 <param name='apply_right_position_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim sequences at the 3'-end by a defined number of positions?" help="By default, no position trimming is made"/> | |
304 <when value="yes"> | |
305 <param name="value" type="integer" min="0" max="3000" value="100" label="Number of positions to trim on 3'-end" help=""/> | |
306 </when> | |
307 </conditional> | |
308 </when> | |
309 </conditional> | |
310 <conditional name="percentage_position_trimming_treatments"> | |
311 <param name='apply_percentage_position_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim sequences by a defined percentage of read length?" help="By default, no position trimming is made. The trim length is rounded towards the lower integer"/> | |
312 <when value="yes"> | |
313 <conditional name="left_percentage_position_trimming_treatments"> | |
314 <param name='apply_left_percentage_position_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim sequences at the 5'-end by a defined percentage of read length?" help="By default, no position trimming is made. The trim length is rounded towards the lower integer"/> | |
315 <when value="yes"> | |
316 <param name="value" type="integer" min="0" max="100" value="2" label="Percentage of positions to trim on 5'-end" help=""/> | |
317 </when> | |
318 </conditional> | |
319 <conditional name="right_percentage_position_trimming_treatments"> | |
320 <param name='apply_right_percentage_position_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim sequences at the 3'-end by a defined percentage of read length?" help="By default, no position trimming is made. The trim length is rounded towards the lower integer"/> | |
321 <when value="yes"> | |
322 <param name="value" type="integer" min="0" max="100" value="2" label="Percentage of positions to trim on 3'-end" help=""/> | |
323 </when> | |
324 </conditional> | |
325 </when> | |
326 </conditional> | |
327 </when> | |
328 </conditional> | |
329 <conditional name="tail_trimming_treatments"> | |
330 <param name='apply_tail_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim tails?" help="By default, no tail trimming is made"/> | |
331 <when value="yes"> | |
332 <conditional name="a_t_tail_trimming_treatments"> | |
333 <param name='apply_a_t_tail_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim poly-A/T tail?" help="By default, no poly-A/T tail trimming is made"/> | |
334 <when value="yes"> | |
335 <conditional name="left_a_t_tail_trimming_treatments"> | |
336 <param name='apply_left_a_t_tail_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim poly-A/T tail at the 5'-end?" help="By default, no 5'-end poly-A/T tail trimming is made"/> | |
337 <when value="yes"> | |
338 <param name="value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-A/T to trim at the 5'-end" help=""/> | |
339 </when> | |
340 </conditional> | |
341 <conditional name="right_a_t_tail_trimming_treatments"> | |
342 <param name='apply_right_a_t_tail_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim poly-A/T tail at the 5'-end?" help="By default, no 3'-end poly-A/T tail trimming is made"/> | |
343 <when value="yes"> | |
344 <param name="value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-A/T to trim at the 5'-end" help=""/> | |
345 </when> | |
346 </conditional> | |
347 </when> | |
348 </conditional> | |
349 <conditional name="ns_tail_trimming_treatments"> | |
350 <param name='apply_ns_tail_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim poly-N tail?" help="By default, no poly-N tail trimming is made"/> | |
351 <when value="yes"> | |
352 <conditional name="left_ns_tail_trimming_treatments"> | |
353 <param name='apply_left_ns_tail_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim poly-N tail at the 5'-end?" help="By default, no 5'-end poly-N tail trimming is made"/> | |
354 <when value="yes"> | |
355 <param name="value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-N to trim at the 5'-end" help=""/> | |
356 </when> | |
357 </conditional> | |
358 <conditional name="right_ns_tail_trimming_treatments"> | |
359 <param name='apply_right_ns_tail_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim poly-N tail at the 5'-end?" help="By default, no 3'-end poly-N tail trimming is made"/> | |
360 <when value="yes"> | |
361 <param name="value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-N to trim at the 5'-end" help=""/> | |
362 </when> | |
363 </conditional> | |
364 </when> | |
365 </conditional> | |
366 </when> | |
367 </conditional> | |
368 <conditional name="quality_trimming_treatments"> | |
369 <param name='apply_quality_trimming_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Trim sequence by quality score?" help="By default, a 3'-end trimming is made to remove ends with a minimum quality score over 5 bp below 20"/> | |
370 <when value="yes"> | |
371 <conditional name="left_quality_trimming_treatments"> | |
372 <param name='apply_left_quality_trimming_treatments' type='boolean' checked="false" truevalue='yes' falsevalue='no' label="Trim sequence by quality score from the 5'-end?" help="By default, no 5'-end quality trimming is made"/> | |
373 <when value="yes"> | |
374 <param name="value" type="integer" min="0" max="40" value="20" label="Quality score threshold to trim positions" help=""/> | |
375 </when> | |
376 </conditional> | |
377 <conditional name="right_quality_trimming_treatments"> | |
378 <param name='apply_right_quality_trimming_treatments' type='boolean' checked="true" truevalue='yes' falsevalue='no' label="Trim sequence by quality score from the 3'-end?" help="By default, 3'-end trimming is made based on a score of 20"/> | |
379 <when value="yes"> | |
380 <param name="value" type="integer" min="0" max="40" value="20" label="Quality score threshold to trim positions" help=""/> | |
381 </when> | |
382 </conditional> | |
383 <param name="type_quality_trimming_treatments" type="select" display="radio" label="Type of quality score calculation to use" help="By default, min is used"> | |
384 <option value="min" selected="true">Mininum</option> | |
385 <option value="mean" >Mean</option> | |
386 <option value="max" >Max</option> | |
387 <option value="sum" >Sum</option> | |
388 </param> | |
389 <param name="rule_quality_trimming_treatments" type="select" display="radio" label="Rule tu use to compare quality score to calculated value" help="By default, 'less than' is used"> | |
390 <option value="lt" selected="true">Less than</option> | |
391 <option value="gt" >Greater than</option> | |
392 <option value="et" >Equal to</option> | |
393 </param> | |
394 <param name="window_quality_trimming_treatments" type="integer" min="0" max="300" value="1" label="Size of the sliding window used to calculated quality score by type" help="To stop at the first base that fails the rule defined, use a window size of 1 (default value)"/> | |
395 <param name="step_quality_trimming_treatments" type="integer" min="0" max="300" value="1" label="Step size used to move the sliding window" help="To move the window over all quality scores without missing any, the step size sould be less or equal to the window size. The default value is 1."/> | |
396 </when> | |
397 </conditional> | |
398 </when> | |
399 </conditional> | |
400 </inputs> | |
401 | |
402 <outputs> | |
403 <data format="fastq" name="good_sequence_file" metadata_source="input_sequence_file"/> | |
404 </outputs> | |
405 | |
406 <tests> | |
407 <test> | |
408 <param name="input_sequence_file" value="input_sequences.fastq"/> | |
409 <output name="good_sequence_file" file="output_sequences.fastq"/> | |
410 </test> | |
411 </tests> | |
412 | |
413 <help><![CDATA[ | |
414 | |
415 **What it does** | |
416 | |
417 PRINSEQ is a tool for easy and rapid quality control and data processing of metagenomic and metatranscriptomic datasets. | |
418 This tool allow to process the sequences with filtering and trimming. | |
419 More information on `PRINSEQ manual <http://prinseq.sourceforge.net/manual.html>`_. | |
420 | |
421 ----- | |
422 | |
423 **Input** | |
424 | |
425 The input file is sequence file in fastq format (sequences and quality):: | |
426 | |
427 @HWI-M00234:263:000000000-ADM55:1:1101:7508:4067 1:N:0:ATCACG | |
428 GGTGCACTAGGATCGTAGTTGGCTACTTTCCCGTTTTCAATGTATACGCAAGGTACACGGTCAGCGGT | |
429 + | |
430 CCCCCGFGED8DDCAFDAEE9DFGGGG9CFAFFCC@@CFGFGGCGFGG>GGGFFGDGEFFEFG8>4GF | |
431 | |
432 ----- | |
433 | |
434 **Parameters** | |
435 | |
436 The parameters are numerous in PRINSEQ | |
437 | |
438 - Filtering parameters to eliminate sequences | |
439 - Filters based on sequence length | |
440 - Filters based on quality score | |
441 - Filters based on base content | |
442 - Trimming parameters to eliminate sequence parts | |
443 - Trim of ends | |
444 - Trim of tails | |
445 - Trim based quality score | |
446 | |
447 ----- | |
448 | |
449 **Output** | |
450 | |
451 The output file is a sequence file with sequences and quality from input file | |
452 which have undergone filter and trimming. | |
453 | |
454 ]]> | |
455 </help> | |
456 | |
457 <citations> | |
458 <citation type="doi">10.1093/bioinformatics/btr026</citation> | |
459 </citations> | |
460 </tool> |